Three groups were tested, including a negative control with only plasmid pCMV-MCS-FLAG, WT with pCMV-MCS-FLAG-WT-CTCF, and experimental groups with pCMV-MCS-FLAG-MUT- CTCF of c.1699C>T. To determine the mRNA level under the impact of the CTCFR567W variant, we performed qPCR assays in three groups in three cell lines, including HEK-293T, LO2, and LCLs. Total RNA was obtained using an easy Isolation Reagent (Vazyme). cDNA was obtained using the HiScript Ⅲ 1st Strand cDNA Synthesis Kit (Vazyme). Primers were designed by NCBI-Primer Blast (National Center for Biotechnology Information (NCBI)) (Supplementary Table 1) and synthesized by Sangon Biotech. Messenger RNA (mRNA) expression levels were quantified by Applied Biosystems StepOnePlus Real-Time PCR System using 2×ChamQ Universal SYBR qPCR Master Mix (Vazyme). At least three independent experiments were conducted. Data were expressed as mean ± s.d. and analyzed using t-test.
Steponeplus real time pcr system
Manufactured by Vazyme
Sourced in China
The StepOnePlus Real-Time PCR System is a compact, reliable, and easy-to-use instrument designed for real-time PCR analysis. It offers precise temperature control and sensitive detection capabilities for a wide range of applications.
Automatically generated - may contain errors
Lab products found in correlation
Chamq universal sybr qpcr master mix, by Vazyme (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Hiscript 3 1st strand cdna synthesis kit, by Vazyme (1 mentions)
Transcriptor first strand cdna synthesis kit, by Roche (1 mentions)
Sybr qpcr master mix, by Vazyme (1 mentions)
Primescript rt reagent, by Takara Bio (1 mentions)
Faststart universal sybr green master, by Vazyme (1 mentions)
Hiscript q rt supermix for qpcr, by Vazyme (1 mentions)
Chamq sybr qpcr master mix, by Vazyme (1 mentions)
Superscript 3 rt, by Vazyme (1 mentions)
Trizol reagent, by Merck Group (1 mentions)
7 protocols using steponeplus real time pcr system
1
Quantifying CTCF Variant Impact on mRNA
2
Quantitative RT-PCR Analysis in C. elegans
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using the Trizol method. cDNA was synthesized using Transcriptor First Strand cDNA Synthesis Kit (Roche). Quantitative real-time PCR was performed using a StepOne Plus Real-Time PCR system and SYBR qPCR Master Mix (Vazyme). RNA fold change was calculated by comparing mRNA levels of the gene of interest with mRNA levels of the reference gene tbg-1. The primers used in this study are listed in Supplementary Table S6.
3
Quantitative Verification of Differential Gene Expression in Chicken Muscle
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nine genes were selected from the DEG of breast muscle and thigh muscle for quantitative verification. The primers were designed using Primer3 (v.0.4.0). qRT-PCR was determined using the Step-One plus Real-Time PCR System with ChamQ Universal SYBR qPCR Master Mix (#Q441-02, Vazyme, Nanjing, China). The information on primers is listed in Supplementary Table S1 . The 20 μL reaction mixture contained 10 μL 2× ChamQ Universal SYBR qPCR Master Mix, 0.4 μL forward primer, 0.4 μL reverse primer, 2 μL cDNA, and 7.2 μL ddH2O. The procedure was as follows: 30 s of pre-denaturation at 95, followed by 40 cycles of 95 °C for 10 s and 60 °C for 30 s, solubility curve period at 95 °C for 15 s, 60 °C for 1 min, and 95 °C for 15 s. Expression of all genes was normalized to the GAPDH level. The relative mRNA expression levels were calculated using the normalized relative quantification method followed by 2−ΔΔCT.
4
Quantitative RT-PCR Analysis of DACT1 in Gastric Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DACT1 mRNA expression levels were analyzed by quantitative reverse transcription–polymerase chain reaction (PCR) using total RNA extracted from 76 pairs of cancerous and normal gastric tissue samples using Trizol reagent (Thermo Fisher Scientific). Total RNA was reversely transcribed to first-strand complementary DNA using Primescript RT Reagent (Takara, Otsu, Japan). The real-time PCR primers for DACT1 were as follows: forward primer 5′-TGTGAATCCCAAGTACCAGTGT-3′ and reverse primer 5′-CCGTCAGACAAAGGAGAAACATT-3′. β-Actin was used to normalize DACT1 gene expression levels and amplified with forward primer 5′-AGAAAATCTGGCACCACACC-3′ and reverse primer 5′-TAGCACAGCCTGGATAGCAA-3′. Amplification reactions were executed in a 10 µL reaction volume containing 0.2 µL primers, 5 µL Master mix, and 100 ng complementary DNA. The cycling conditions were set at 95°C for 5 minutes, followed by 40 cycles at 95°C for 10 seconds and 60°C for 30 seconds. Real-time PCR was carried out using FastStart Universal SYBR-Green Master (Vazyme, Nanjing, People’s Republic of China) with the StepOnePlus Real-Time PCR System in triplicate. The 2−ΔCT algorithm was used for calculating the expression of individual DACT1 relative to expression of β-actin.4 (link)
5
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
cDNA was synthesized from 0.5 μg of total RNA with HiScript®Q RT SuperMix for qPCR (Vazyme, China) according to the protocol. Quantitative RT-PCR was conducted using the StepOnePlus Real Time PCR system with ChamQ SYBR qPCR Master Mix (Vazyme, China). Gene specific primers (Table S2 ) were designed with QuantPrime qPCR primer design tool (https://quantprime.mpimp-golm.mpg.de ). The primers ZmUBQ-qRT+/− were used to amplify the ubiquitin1 as control, and the relative gene expression data was calculated using 2-△△Ct method. Each sample had three biological repetitions with three technical replicates to minimize experimental error.
6
Quantitative RT-PCR and ChIP Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Samples from all quantitative RT-PCR (RT-qPCR) and ChIP experiments were analyzed using the Biosystems StepOnePlus Real-Time PCR System with Q712-00 Taq Pro Universal SYBR qPCR Master mix (Vazyme). The results were standardized to those of ornithine decarboxylase, a ubiquitous gene in Xenopus embryos that is expressed throughout embryonic development. Graphs were generated using the threshold cycle (Ct) values, delta cycle thresholds, delta-delta cycle thresholds, and the relative fold-change expression method.
7
Quantitative RT-PCR analysis of cytokine expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cervical spinal cord, the skin of neck and HaCat cells were collected in RNase-free condition sand isolated total RNAs using TRIzol reagent (Sigma-Aldrich). RNA (1 mg) was reverse transcribed for each sample using SuperScript III RT (Vazyme). The sequences of the forward and reverse primers for:
IL-6: Forward: TCCATCCAGTTGCCTTCTTGG; Reverse: CCACGATTTCCCAGAGAACATG;
IL-17α: Forward: AGTGTTTCCTCTACCCAGCAC; Reverse: GCCACTGCCTCGTATTGAGT;
IL-33: Forward: TCCTTGCTTGGCAGTATCCA; Reverse: TGCTCAATGTGTCAACAGACG;
IL-1β: Forward: TGTCTTGGCCGAGGACTAAG; Reverse: TGGGCTGGACTGTTTCTAATG;
Gapdh: Forward: TCCATGACAACTTTGGCATTG; Reverse: CAGTCTTCTGGGTGGCAGTGA;
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!