Log In Sign up
The largest database of trusted experimental protocols

Sec31a

Manufactured by BD
Visit Supplier
Sourced in United States

Sec31A is a laboratory equipment product designed for specialized applications. It is a multi-purpose device capable of performing various analytical and processing tasks. The core function of Sec31A is to provide reliable and precise results for researchers and scientists working in diverse fields. Further details about its intended use or specific capabilities are not available at this time.

Automatically generated - may contain errors

Lab products found in correlation

Tango1, by Merck Group (5 mentions) Tgn46, by Bio-Rad (5 mentions) Prolong, by Thermo Fisher Scientific (4 mentions) Vectashield, by Vector Laboratories (4 mentions) Ergic 53, by Santa Cruz Biotechnology (3 mentions) Calreticulin, by Enzo Life Sciences (3 mentions) Hsp47 and calreticulin, by Enzo Life Sciences (2 mentions) Procollagen 7, by Abcam (2 mentions) Sec16a, by Merck Group (2 mentions) β actin, by Merck Group (2 mentions) Collagen 7, by Abcam (1 mentions) C myc, by Merck Group (1 mentions) Sec23, by Abcam (1 mentions) β tubulin, by Merck Group (1 mentions) Hsp60, by Merck Group (1 mentions) Flag tag (flag), by Merck Group (1 mentions) Calreticulin, by Novus Biologicals (1 mentions) Hsp47, by Enzo Life Sciences (1 mentions) Sec23a, by Thermo Fisher Scientific (1 mentions) Superscript 3 first strand rt pcr kit, by Thermo Fisher Scientific (1 mentions)

7 protocols using sec31a

1

Immunocytochemistry Antibody Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following antibodies were used in immunocytochemistry: collagen VII (rabbit anti–human [Abcam]; mouse anti–human [Sigma-Aldrich]), ERGIC-53 (mouse anti–human; Santa Cruz Biotechnology, Inc., and Enzo Life Sciences), Sec31A (mouse anti–human; BD), TANGO1 (rabbit anti–human; Sigma-Aldrich), HSP47 and calreticulin (goat anti–human; Enzo Life Sciences), HA (mouse; BioLegend), SAR1 (mouse anti–human; Abcam), TGN46 (Bio-Rad Laboratories), and mannosidase II (rabbit anti–human; Bio-Rad Laboratories and Merck). Mounting media used in confocal and STED microscopy were either Vectashield (Vector Laboratories) or ProLong (Thermo Fisher Scientific).
Raote I., Ortega Bellido M., Pirozzi M., Zhang C., Melville D., Parashuraman S., Zimmermann T, & Malhotra V. (2017). TANGO1 assembles into rings around COPII coats at ER exit sites. The Journal of Cell Biology, 216(4), 901-909.
+ Open protocol
+ Expand
2

Antibody Characterization Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following antibodies were used procollagen VII (rabbit anti–human [Abcam]; mouse anti–human [Sigma-Aldrich]), Sec31A (mouse anti–human; BD), TANGO1 (rabbit anti–human; Sigma-Aldrich), sec16A (rabbit anti-human; Sigma-Aldrich), calreticulin (goat anti–human; Enzo Life Sciences), HA (mouse; BioLegend), TGN46 (sheep polyclonal, Bio-Rad), HA (mouse monoclonal, BioLegend; rat monoclonal BioLegend). Mounting media used in confocal and STED microscopy were either Vectashield (Vector Laboratories) or ProLong (Thermo Fisher Scientific, Waltham, Massachusetts).
Raote I., Ernst A.M., Campelo F., Rothman J.E., Pincet F, & Malhotra V. (2020). TANGO1 membrane helices create a lipid diffusion barrier at curved membranes. eLife, 9, e57822.
+ Open protocol
+ Expand
3

Antibody Characterization in Cell Biology

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following antibodies were used collagen VII (rabbit anti–human [Abcam]; mouse anti–human [Sigma-Aldrich]), ERGIC-53 (mouse anti–human; Santa Cruz Biotechnology, Inc., and Enzo Life Sciences), Sec31A (mouse anti–human; BD), TANGO1 (rabbit anti–human; Sigma-Aldrich; rabbit anti-human in-house), HSP47 and calreticulin (goat anti–human; Enzo Life Sciences), HA (mouse; BioLegend), SAR1 (mouse anti–human; Abcam), β-tubulin (mouse anti-human; SIGMA-Aldrich), β-actin (mouse anti-human; SIGMA-Aldrich), NBAS (rabbit anti-human SIGMA-Aldrich), RINT1 (rabbit anti-human; SIGMA-Aldrich and goat anti-human (Santa Cruz Biotechnology), ZW10 (rabbit anti-human; Abcam), Sec23 (rabbit anti-human/mouse/rat; Abcam), cTAGE5 (rabbit anti-human Atlas antibodies, mouse anti-human Santa Cruz Biotechnology), TGN46 (sheep polyclonal, Bio-Rad), HA (mouse monoclonal, BioLegend; rat monoclonal BioLegend), FLAG (mouse monoclonal, rabbit, SIGMA-Aldrich; goat, Novus) HSP60 (mouse anti-human SIGMA-Aldrich), c-myc (mouse monoclonal, rabbit, SIGMA-Aldrich). Mounting media used in confocal and STED microscopy were either Vectashield (Vector Laboratories) or ProLong (Thermo Fisher Scientific, Waltham, Massachusetts).
Raote I., Ortega-Bellido M., Santos A.J., Foresti O., Zhang C., Garcia-Parajo M.F., Campelo F, & Malhotra V. (2018). TANGO1 builds a machine for collagen export by recruiting and spatially organizing COPII, tethers and membranes. eLife, 7, e32723.
+ Open protocol
+ Expand
4

Antibodies for Western Blotting and Immunofluorescence

Check if the same lab product or an alternative is used in the 5 most similar protocols
Antibodies used in Western blotting and immunofluorescence microscopy were as follows: EGFP (Roche); TANGO1 and α-tubulin (Sigma-Aldrich); cTAGE5 (Atlas Antibodies); apolipoprotein B (Tebu-bio); apolipoprotein E, GRP78/BIP, PDI, and LAMP1 (Abcam); Sec31A (BD); calreticulin (Novus Biologicals); and LC3, ERGIC-53, and collagen XII (Santa Cruz). For the coimmunoprecipitation experiments, besides the anti-TANGO1 and anti-cTAGE5 antibodies, an anti-MIA2 antibody (Antigenix America) was used.
Santos A.J., Nogueira C., Ortega-Bellido M, & Malhotra V. (2016). TANGO1 and Mia2/cTAGE5 (TALI) cooperate to export bulky pre-chylomicrons/VLDLs from the endoplasmic reticulum. The Journal of Cell Biology, 213(3), 343-354.
+ Open protocol
+ Expand
5

Antibody Panel for Cell Biology Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Antibodies used in western blotting and immunocytochemistry; Col VII and ATP5A1 (Abcam, Cambridge UK), Syntaxin 18 (Santa Cruz Biotechnology, Dallas, USA), ERGIC-53 (Santa Cruz Biotechnology, Dallas, USA; Enzo Life Sciences, Farmingdale, New York, USA), Sec31A (BD Biosciences), TANGO1, YKT6, c-Myc (9E10), c-Myc and alpha-tubulin (SIGMA-Aldrich, St. Louis, MO, USA), Mannosidase II (Merck, Kenilworth, NJ, USA), TGN46 (abd serotec, Kidlington, UK), HSP47 and Calreticulin (Enzo Life Sciences, Farmingdale, New York).
Santos A.J., Raote I., Scarpa M., Brouwers N, & Malhotra V. (2015). TANGO1 recruits ERGIC membranes to the endoplasmic reticulum for procollagen export. eLife, 4, e10982.
+ Open protocol
+ Expand
6

Immunoblotting and RT-qPCR Techniques

Check if the same lab product or an alternative is used in the 5 most similar protocols
Immunoblotting studies were conducted as described previously (43 (link)). The following validated antibodies were used: Sec31a (BD Sciences; 612351), Sec23a (Thermo Scientific; PA5-28984), TFG (Novus Biologicals; NBP2-62212), β-actin (Sigma; A1978), GAPDH (Proteintech; 60004-1), and GRP78/BIP (Proteintech; 11587-1-AP).
RNA extraction was performed using TRIzol (Invitrogen), followed by sequential precipitations using ethanol and lithium chloride. Production of cDNA was performed using a Superscript III First Strand RT-PCR kit (Invitrogen), and RT-qPCR experiments were performed using a CFX384 Touch Real-time PCR detection system (Bio-Rad) and Applied Biosystems Power SYBR Green PCR Master Mix (Thermo Scientific). The following primers were used: sXBP1 F: CCCTCCAGAACATCTCCCCAT; sXBP1 R: ACATGACTGGGTCCAAGTTGT; GAPDH F: AGCCACATCGCTCAGACAC; GAPDH R: GCCCAATACGACCAAATCC.
Kasberg W., Luong P., Swift K.A, & Audhya A. (2023). Nutrient deprivation alters the rate of COPII coat assembly to tune secretory protein transport. Research Square.
+ Open protocol
+ Expand
7

Immunofluorescence Antibody Panel Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following antibodies were used procollagen VII (rabbit anti-human [Abcam]; mouse anti-human [Sigma-Aldrich]), Sec31A (mouse anti-human; BD), TANGO1 (rabbit antihuman; Sigma-Aldrich), sec16A (rabbit anti-human; Sigma-Aldrich), calreticulin (goat antihuman; Enzo Life Sciences), HA (mouse; BioLegend), TGN46 (sheep polyclonal, Bio-Rad), HA (mouse monoclonal, BioLegend; rat monoclonal BioLegend). Mounting media used in confocal and STED microscopy were either Vectashield (Vector Laboratories) or ProLong (Thermo Fisher Scientific, Waltham, Massachusetts) .
Raote I., Ernst A.M., Campelo F., Rothman J.E., Pincet F., & Malhotra V. (2020). TANGO1 membrane helices create a lipid diffusion barrier at curved membranes.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!