qChIP was performed as described [25 (link),26 (link)]. Briefly, 14-day-old seedlings were cross-linked with formaldehyde, chromatin was isolated, sheared by sonication, and immunoprecipitated with 5–6 μg of anti-acetyl-histone H3 antibody (Millipore, 06–599). The cross-linking was heat-reversed at 65 °C, DNA purified on spin columns (Zymogen), and quantitative PCR was performed with the following primer pairs specific for regions #1–5 within the 5′ UTR of PLDζ1: region #1, 5′AGTTTACCTGTAGAAGAAGC3’/5′ACATGGTTGAACAAGTAACT3’; region #2, 5′GAGTAGTATCACACTTCCCA3’/5′CCCACGTATTCATAGAATCA3’; region #3, 5′GAATACGTGGGGTAAGATTG3’/5′CGGATCCGGCTATATATTAT3’; region #4.5′ATAATATATAGCCGGATCCG3’/5′ACAAAGGAAGACAAATCTGA3’; and region #5, 5′GGGAGTATAAGCATAACGAA3’/5′GATGCCATTTCTCTGATCTC3’. Relative abundance of the PLDζ1-specific PCR products was normalized to the amount of the Act8-specific product.
Anti acetyl histone h3 antibody
Manufactured by Merck Group
Sourced in United States, Germany
The Anti-acetyl-histone H3 antibody is a laboratory reagent used for the detection and analysis of acetylated histone H3 proteins. It is a specific antibody that recognizes the acetylated form of histone H3, a core component of chromatin. This antibody can be used in various applications, such as Western blotting, immunoprecipitation, and chromatin immunoprecipitation (ChIP), to study histone acetylation and its role in gene regulation and epigenetic processes.
Automatically generated - may contain errors
Lab products found in correlation
Chip assay kit, by Merck Group (3 mentions)
Anti histone h3 antibody, by Cell Signaling Technology (2 mentions)
Ez chip kit, by Merck Group (2 mentions)
Ez chip chromatin immunoprecipitation kit, by Merck Group (1 mentions)
Whole genome amplification kit, by Merck Group (1 mentions)
Nimblegen dual colordna labeling kit, by Roche (1 mentions)
Anti e2f1 antibody, by Abcam (1 mentions)
Ez magna chip tma kit, by Merck Group (1 mentions)
Sybr green, by Takara Bio (1 mentions)
Loading buffer, by Bio-Rad (1 mentions)
Anti acetyl α tubulin antibody, by Merck Group (1 mentions)
Roti pvdf, by Carl Roth (1 mentions)
Anti cd68 antibody, by Bio-Rad (1 mentions)
Anti gfap antibody, by Agilent Technologies (1 mentions)
Alexa488 or 568 conjugated secondary antibodies, by Thermo Fisher Scientific (1 mentions)
Anti neun antibody, by Merck Group (1 mentions)
Protein assay, by Bio-Rad (1 mentions)
Anti histone h3 antibody, by Merck Group (1 mentions)
Amersham hybond, by Cytiva (1 mentions)
Epiquik total histone extraction kit, by Epigentek (1 mentions)
21 protocols using anti acetyl histone h3 antibody
1
Chromatin Immunoprecipitation for PLDζ1
2
Acetyl-H3 ChIP-chip Analysis of T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The DNA immunoprecipitate samples were pooled from four type 1 diabetes patients or five healthy controls in equal quantities of CD4+ T lymphocytes in total. One pooled sample consisting of 3 million mixed CD4+ T lymphocytes was used for sonication. Sonicate cell lysate was divided into three aliquots, and one aliquot contained approximate 1 million cell equivalents of chromatin, which was used for immunoprecipitation with 5.0 μg anti‐acetyl histone H3 antibody (#06‐599; Millipore). Before the antibody was added, 10 μL of the sonicate cell lysate supernatant was removed as input. The EZ ChIP™ Chromatin Immunoprecipitation Kit (#17‐371, Millipore) was used to carry out the chromatin immunoprecipitation (ChIP) assay and DNA purification. DNA was amplified with the Whole Genome Amplification kit from Sigma‐Aldrich (Darmstadt, Germany). Fluorescent labeling of the DNA was carried out using the NimbleGen Dual‐Color DNA Labeling Kit (F. Hoffman‐La Roche Ltd., Basel, Switzerland). Each pooled sample was labeled and hybridized to Roche Nimblegen human 720K RefSeq promoter tiling arrays, with probes designed to cover –3,200–800 bp regions relative to the transcription start sites of 22,542 Refseq genes, to detect sheared DNA pulled down by acetyl‐H3 antibody at promoter regions. Hybridizations were carried out by KangChen Bio‐tech Inc. (Shanghai, China).
3
Chromatin Immunoprecipitation of Klotho Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromatin immunoprecipitation assay (ChIP) was carried out with a ChIP assay kit (Millipore, Billerica, MA) according to the manufacturer’s instructions. The Immunoprecipitation was performed with anti-acetyl histone H3 antibody (Millipore, Billerica, MA) or an isoform-matched IgG as control. Immunoprecipitated DNA was further PCR-amplified using primer set specific for mouse Klotho promoter mKLpF (5′-GCTGAGTTGTACCTTACTGAG-3′) and mKLpR (5′-CACCATATCCCGTTCATCAC-3′). PCR amplification profiles: 94 °C for 5 min followed by 94 °C 30 sec, 55 °C 1 min, 72 °C 1 min for a total of 30 cycles and a final 72 °C for 10 min. The PCR products were analyzed on 1.5% agarose gel and visualized under UC light.
4
ChIP Assay for Histone Acetylation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP assays were performed with the EZ-Magna ChipTM A kit (Millipore) according to the manufacturer’s instructions. A total of 1×107 Hela cells were fixed in 1% formaldehyde at room temperature for 10 min. The cell lysates were sonicated to generate 200–1,000 bp DNA fragments. Then immunoprecipitated with anti-IgG antibody (Millipore), anti-E2F1 antibody (Abcam) and anti-acetyl histone H3 antibody (Millipore). After reverse cross-linking and DNA purification, DNA from input or immunoprecipitated samples were assayed by qRT-PCR using SYBR Green (Takara) with the following primer: 5ʹ-GGGCTTCAATGGGTCAAGG-3ʹ (sense); 5ʹ-GCCTTCGGTGTATTTCCCTG-3ʹ (antisense).
5
Quantifying Histone and Tubulin Acetylation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HL60 cells were treated with the inhibitors in the given concentrations. Cells treated with dimethyl sulfoxide as a vehicle were used as controls. After an incubation time of 4 h, cells were transferred into 50-mL Falcon tubes and centrifuged (300× g, 5 min). The supernatant was removed, and the cells were washed with PBS, before they were transferred to 1.7-mL reaction tubes. The cells were lysated with Bio-Rad loading buffer, and the cell suspension was heated to 95 °C for 5 min. The proteins then were separated using a 15% SDS-polyacrylamide gel electrophoresis and transferred to a polyvinylidene fluoride (PVDF) membrane (Roti-PVDF, Carl Roth, Karlsruhe, Germany). Acetylation levels were detected using an anti-acetyl histone H3 antibody (Millipore, Billerica, MA, USA) and an anti-acetyl-α-tubulin antibody (Sigma Aldrich, St. Louis, MO, USA). An antibody directed against GAPDH (Sigma Aldrich) was used as a loading control.
6
Histological Analysis of Spinal Cord Injury
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Spinal cord sections were prepared 3 days after SCI and brain sections were prepared 14 days after SCI. The sections were immunostained using the following antibodies: anti-GFAP antibody (Dako), anti-myeloperoxidase antibody (Thremo Scientific or Abcam, Cambridge, UK), anti-CD68 antibody (AbD Serotec, Oxford, UK), anti-NeuN antibody, and anti-acetyl-histone H3 antibody (Millipore), alexa 488- or 568-conjugated secondary antibodies (Molecular Probes, Eugene, OR, USA). Alexa 488-conjugated streptavidin was used for the visualization of BDA. The lesion depth from the dorsal surface of the spinal cord was measured following immunostaining with the anti-GFAP antibody.
7
Histone Extraction and Immunoblotting
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total histones were extracted from the frozen panicle samples using the EpiQuik Total Histone Extraction kit (Epigentek, Cat.# OP-0006) following the protocol. Concentration of the eluted protein was measured by the Bradford method according to the manufacturer’s instructions (Bio-Rad protein assay, Hercules, CA, USA). For immunoblotting, the histone samples were diluted with SDS loading buffer, and 20 μg proteins of each sample were separated by 16.5% SDS-PAGE and electro-blotted onto PVDF blotting membrane (Amersham Hybond, Cytiva). The blot was probed with anti-acetyl-histone H3 antibody (Millipore, Cat.# 06-599, 1:1000 dilution), anti-acetyl-histone H3K37 antibody (Active Motif, Cat.# 61 587, 1:1000 dilution), or anti-histone H3 antibody (Sigma, Cat.# SAB5701101, 1:1000 dilution).
8
Epigenetic Modulation of Cancer Cells
9
Histone Modification Analysis
10
Inducible Prdm16 Regulation of Sost Transcription
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MC3T3-E1 cells were transduced with the pINDUCER20-Prdm16 virus and selected with G-418 to generate cells with inducible expression of Prdm16. Cells were maintained in the medium without doxycycline. Cells were seeded at 5 × 104 cells per cm2 into 20 mm Petri dishes with or without 1 μM doxycycline. Twenty-four hours later, the medium was changed to a serum-free medium with or without 1 μM doxycycline, and 24 h later the medium was changed to a serum-free medium with or without 1 μM doxycycline and 10 ng μl−1 TGF-β1 (R&D Systems). Finally, 24 h later, the cells were collected with Magna ChIP A/G One-Day Chromatin Immunoprecipitation Kits (Millipore). The sheared chromatin was immunoprecipitated with 10 μg ml−1 anti-Prdm16 antibody (R&D Sysytems, AF6295), 10 μg ml−1 anti-Smad3 antibody (Abcam, ab28379), 10 μg ml−1 anti-Acetyl-Histone H3 antibody (Millipore, 17–615) or 10 μg ml−1 anti-IgG antibody (Millipore, PP64-1KC). DNA was quantified by qRT–PCR with different primer sets and normalized with input DNA of each group. The 2 kb upstream region from the mouse Sost transcription start site was divided into six regions (S1–S6). Only the S3 region (Fig. 3f ,1,036–1,328 bp upstream from transcription start site) exhibited significantly difference among treatments.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!