Amplitaq gold 360

All sequence mutations (including SNVs and indels) and a subset of SVs selected from WXS and CGI WGS analysis (with selection criteria described in the data analysis section) were subjected to experimental verification. An exception was made for two hypermutators with >300 relapse-specific mutations, PAPNNX and PASFXA: ~100 SNVs were selected for verification for each case. The targeted regions were submitted for probe design to Nimblegen/Roche using Nimbledesign V1.2. Library construction was performed using the NextFlex DNA Sequencing library prep kit (Bioo Scientific, Austin, TX). Targeted enrichment was conducted according to manufacturer’s recommendations (Roche), NGS sequencing using the PE100 protocol with V3 reagents was performed on a HiSeq 2000. The overall verification rate was 98%. The verified variants and high-quality putative variants not subjected for verification are listed in Supplementary Data 2 and were used for clonal evolution analysis. The verification for 24 SNVs was supplemented by amplicon NGS using a MiSeq (PE 150 cycle protocol). The PCR amplification was accomplished using Amplitaq Gold 360 (Life Technologies). The Nextera XT library construction kit (Illumina) was used to generate NGS libraries from the amplicons.

DNA was extracted using Puregene kits (Qiagen Inc., Germantown, MD, USA). PCR was performed on an Applied Biosystems (ABI) 9600 thermocycler using TAAR1 specific primers (Forward 5’ CCTGATTATGGATTTGGGAAAA 3’ Reverse 5’ TCATAAAGGTCAGTACCCCAGA 3’) using Amplitaq gold 360 (Applied Biosystems, Foster City, CA, USA). DNA sequencing was performed using ABI BigDye v3.1 cycle sequencing reagents and analyzed on an ABI 3130XL Genetic Analyzer. DNA extraction quality analysis of 12 samples found that the 260/280 ratios were between 1.7 and 2.0 and all 260/230 ratios were greater than 1.5; the yields ranged from 7–27 μg at a concentration between 37 and 127 ng/μl. The variation in yield was due to differences in the initial cell numbers. Average yield was 19 μg and 92 ng/μl.

Diagnostic PCR was applied to genomic DNA extracted from stool specimens using the F1 (5'-GGA GGT AGT GAC AAT AAA TC-3') and R1 (5'-CGT TCA TGA TGA ACA ATT AC-3') primers [26 (link)]. Briefly, 2 μl of genomic DNA was used in PCR reactions of a 25 μl final volume using the AmpliTaq Gold 360 master mix (Applied Biosystems, CA, USA). The PCR conditions consisted of one cycle of initial denaturation at 94 °C for 4 min, followed by 35 cycles of denaturation at 94 °C for 30 s, annealing at 54 °C for 30 s, extension at 72 °C for 30 s, and a final elongation cycle for 5 min at 72 °C.

All C. jejuni isolates were analyzed by PCR for the presence of genes encoding the putative virulence factors, fucose permease (fucP) and the iron transport protein (ceuE). Furthermore all human isolates and 45 chicken isolates were screened for presence of the genes phospholipase (pldA), the Campylobacter invasion antigen (ciaB) and the plasmid borne virulence gene (virB11). A close to 100 % prevalence of the genes pldA and ciaB as well as very low prevalence of virB11 were expected among the chicken isolates from previous studies, and hence only a subset was selected to verify this [25 (link)]. The reaction mixture was 1x AmpliTaq Gold 360 buffer with 1.25U of AmpliTaq Gold 360 polymerase (Applied Biosystems, Austin, USA), 200 μM dNTP (Fermentas, St. Leon-Rot, Germany), 0.2 μM of each primer (Eurogentec, Ougrée, Belgium) and 5 μl of template DNA in a total volume of 25 μl. Cycling conditions were 95 °C for 10 min followed by 25 cycles of 95 °C for 30s, annealing temperatures (fucP: 58 °C, ceuE: 60 °C, pldA: 45 °C, ciaB: 58 °C, virB11: 53 °C) for 30s and 72 °C for 60s. For virB11 a touch down protocol was run with 5 cycles at 53 °C, 5 cycles at 52 °C and 15 cycles at 51 °C. All reactions ended with an extension step at 72 °C for 7 min. C. jejuni NCTC 11168 and C. jejuni 81176 were used as positive controls and omission of template was used as negative control.

The PCR assay was performed at AGRF using a Forward 27 F primer (AGAGTTTGATCMTGGCTCAG) and a Reverse 519 R primer (GWATTACCGCGGCKGCTG)41 (link), with fusion primer sequences for both the forward and reverse directions for each amplicon. Each primer sequence included the appropriate adapter sequence for Lib-L or Lib-A libraries followed by the key sequence of TCAG. This was followed by the unique “barcode” sequences for a GS FLX MID sequencing platform for forward and reverse directions; the barcode sequences were used subsequently to identify and distinguish each of the samples. Table 2 summaries the design structure of the fusion primers, and the 16S rRNA target sequence primers [Adapter]-[Key]-[MID barcode]-[Target primers].
PCR amplification was conducted in 384 well plates using 8 μL total volume per reaction. Each PCR reaction contained: 2 μL DNA template, 4 μL master mix containing Ampli Taq Gold (AmpliTAQ GOLD 360, Applied Biosystems, USA), and 2.25 μM of primers. The PCR cycling parameters were: 94 °C for 3 mins; followed by 34 cycles of 94 °C for 45 sec, 50 °C for 60 sec, 72 °C for 60 sec; a final extension step at 72 °C for 7 mins; and then the reactions were held at 10 °C. All amplicons were purified using a robotic liquid handler (Beckman Coulter 384 Biomek NX, CA, USA) and Agencourt AMPure (Beckman Coulter, CA, USA).