Bamhi restriction enzyme

Manufactured by Thermo Fisher Scientific

Sourced in United States

BamHI is a type II restriction enzyme that recognizes and cleaves the palindromic DNA sequence 5'-GGATCC-3'. It is a widely used tool in molecular biology for DNA manipulation and analysis.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Restriction enzymes (272 citations) BamHI (226 citations) BamHI enzymes (4 citations) BamHI and VspI (AseI) restriction enzymes (2 citations) BamHI and HindIII restriction enzymes (2 citations)

11 protocols using bamhi restriction enzyme

Cloning and Expression of Mecasermin

Check if the same lab product or an alternative is used in the 5 most similar protocols

Recombinant puc57 vector was digested by NcoI and BamHI restriction enzymes (Thermo Scientific, USA) according to manufacturer. Released fragment was excised from agarose gel and purified using DNA extraction kit (Thermo Scientific, USA). Purified DNA fragment was ligated to pET15b expression vector linearized with NcoI and BamHI restriction enzymes to give pET15-mecasermin according to Maniaties and coworkers (26 ).
The construct was transformed into E. coli DH5α and sequenced in both strand. The confirmed plasmid was extracted from DH5α according to alkaline lysis method (26 ) and transformed into Origami B (DE3) and BL21 (DE3) expression hosts.

Jafari S., Babaeipour V., Seyedi H.A., Rahaie M., Mofid M.R., Haddad L., Namvaran M.M, & Fallah J. (2014). Recombinant production of mecasermin in E. coli expression system. Research in Pharmaceutical Sciences, 9(6), 453-461.

+ Open protocol

+ Expand

Enzymatic Kinetic Assays for Lipid Metabolism

Check if the same lab product or an alternative is used in the 5 most similar protocols

All chemicals used were analytical grade. Pepsin from porcine gastric mucosa (>2500 U/mg), pancreatin from porcine pancreas, 3-hydroxy-3-metyl glutaryl-CoA reductase human, NADPH tetrasodium, DL-3Hydroxy-3-methylglutaryl coenzyme A sodium salt hydrate, Angiotensin Converting Enzyme from rabbit lung 2.0 units/mg protein, N-Hippuryl-His-Leu hydrate were purchased from Sigma-Aldrich Chemical Company (St. Louis, MO, USA). NdeI and BamHI restriction enzymes were purchased from Thermofisher Scientific, Waltham, MA, USA.

Maldonado-Torres D.A., Jara-Romero G.J., Rosas-Cárdenas F.D., Fernández-Velasco D.A, & Luna-Suárez S. (2021). Engineering Concanavalin B to Release Bioactive Peptides against Metabolic Syndrome. Foods, 10(7), 1554.

+ Open protocol

+ Expand

E. coli Strain and Protein Expression Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

E. coli strain TOP10 was purchased from TIANGENBIOTECH Co., Ltd. (Beijing, China) and was used for recombinant plasmid amplification. E. coli strain BL21 (DE3) (Vazyme, Nanjing, China) was preserved in the laboratory and was used for protein expression. Porcine Kidney cells (PK-15) was preserved in the laboratory. PK-15 cells were cultured in Dulbecco’s Modified Eagle Medium (DEME) (Corning Inc., NY, USA). All medium were supplemented with 10% (v/v) fetal bovine serum (FBS) (Gibco, New York, NY, USA). The PCV2 strain (GenBank ID: GU325754), stored in our laboratory. The plasmid pET21b (Novagen, Madison, WI, USA) harboring a C-terminal 6 × His tag was used for protein purification and was preserved in the laboratory. The gene cap, JMJD6 and CCT5 were synthesized by GenScript (Nanjing, China). High-affinity Ni-NTA resin was obtained from GenScript. Lysis buffers were purchased from Beyotime Ins.Bio (Shanghai, China). T4 DNA polymerase, Xho I and BamH I restriction enzymes were purchased from Thermo Fisher Scientific (Shanghai, China); Pfu DNA polymerase was purchased from GenStar (Shanghai, China). The transfection reagent was T101-01/02, Vazyme Biotechnology, Nanjing, China). Other chemicals used were purchased from Sigma-Aldrich (Shanghai, China).

Yang X., Yang W., Zhang W., Li J., Yang G., Zhao S, & Zheng Y. (2022). Cap Is the Protease of the Porcine Circovirus 2. Viruses, 14(7), 1550.

+ Open protocol

+ Expand

Plasmid Transfection for Rac1 and POTEE

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Plasmid transfection was carried out with 5 μg of the vectors: pEGFP‐Rac1 wild type (WT), pEGFP‐Rac1∆CT (∆CT), pEGFP‐POTEE, pEGFP‐C3 (empty vector), pGlo‐Myc or Myc‐POTEE (Origene #RC218458, Carlsbad, CA, USA). The pEGFP‐POTEE vector was obtained by subcloning Myc‐POTEE into the pEGFP‐C1 vector using the XhoI and BamHI restriction enzymes (Thermo Scientific, Waltham, MA, USA). The pEGFP‐TRIO or pEGFP‐TRIO dominant negative (DN) vectors were generated as described in [6 (link)]. Cells were transfected using Lipofectamine 2000 (Invitrogen, #11668‐027) and incubated for 24 h before starting the experiments. The IVA cloning system [27 (link)] was used to clone the GFP‐Rac1ΔCT construct, amplified from the pEGFP‐Rac1 WT plasmid using the following primers: Fw ∆CT: CTCAAGACAGTGTTTGACGAATAAGAATTCTGCAGTCGACGGTACCG; Rv ∆CT TTCGTCAAACACTGTCTTGAGTCCTCG.

Martínez‐López A., García‐Casas A., Infante G., González‐Fernández M., Salvador N., Lorente M., Mendiburu‐Eliçabe M., Gonzalez‐Moreno S., Villarejo‐Campos P., Velasco G., Malliri A, & Castillo‐Lluva S. (2023). POTEE promotes breast cancer cell malignancy by inducing invadopodia formation through the activation of SUMOylated Rac1. Molecular Oncology, 18(3), 620-640.

+ Open protocol

+ Expand

Recombinant Plasmid Construction for OnTRAP5b

Check if the same lab product or an alternative is used in the 5 most similar protocols

In order to obtain recombinant plasmid pMD18T-OnTRAP5b, PCR products were ligated into the pMD18 T vector (TaKaRa, Dalian, China) and transformed into competent Escherichia coli cells Top 10. OnTRAP5b was excised from pMD18T-OnTRAP5b by digestion with EcoR 32I and BamH I restriction enzymes (Thermo Fisher Scientific, USA). OnTRAP5b was inserted into pMAL-c5X (New England Biolabs, Ipswich, MA, USA) to produce pMAL-c5X-OnTRAP5b with an MBP-tag at N-terminus for protein purification, using the primer pair OnTRAP5b-F2/R2 (Table 1). To obtain the recombinant eukaryotic expression plasmid pcOnTRAP5b using the primer pair OnTRAP5b-F3/R3 (Table 1), the OnTRAP5b fragment was inserted into pcDNA3.1 vector at BamH I and EcoR 32I to construct overexpression plasmid pcOnTRAP5b. The plasmid pcOnTRAP5b or pcDNA3.1 was transformed in E. coli Top 10 cells. Recombinant plasmids of pMD18T-OnTRAP5b, pMAL-c5X-OnTRAP5b, and pcOnTRAP5b were extracted from positive clones and confirmed by sequencing (Figure S4).

Lei Y., Fu S., Yang Y., Chen J., Li B., Guo Z, & Ye J. (2023). Identification and Functional Analysis of Tartrate-Resistant Acid Phosphatase Type 5b (TRAP5b) in Oreochromis niloticus. International Journal of Molecular Sciences, 24(8), 7179.

+ Open protocol

+ Expand

Constructing Recombinant Plasmid pET-EgDSI2

Check if the same lab product or an alternative is used in the 5 most similar protocols

Construction of the recombinant plasmid was carried out using the restrictionligation method. The EgDSI2 and pET32b vector (Novagen, United States) were double digested with the NdeI and BamHI restriction enzymes (Thermo Scientific, Vilnius, Lithuania). The optimal con dition for the double digest reactions was determined using the DoubleDigest CalculatorThermo Scientific program (https://www.thermofisher.com/id/en/home/brands/therm oscientific/molecularbiology/thermoscientificrestric tionmodifyingenzymes/restrictionenzymesthermosc ientific/doubledigestcalculatorthermoscientific.html). The pET32b and the PCR product of EgDSI2 were double digested with 2X final concentration of buffer Tango (Thermo Scientific, Waltham, USA), 20 U NdeI and 20 U BamHI. The reactions were incubated at 37 o C for 15 min. The whole double digests were loaded into wells of a 0.8% agarose gel for electrophoresis. DNA bands with the desired sizes were extracted from the gel.
The doubledigested EgDSI2 (12 µL) and pET32b (5 µl) were ligated with T4 DNA ligase buffer (Thermo Sci entific, Waltham, USA) and 1 Weiss U T4 DNA ligase (Thermo Scientific, Waltham, USA). The ligation reaction mixture was incubated at 4 o C in a water bath for 16 h. The ligation product was named pETEgDSI2.

Suherman E.A., Moeis M.R., & Restiawaty E. (2020). Cloning and in silico study of an endoglucanase from a thermophilic bacterium isolated from a hydrothermal vent of West Kawio, Sangihe‐Talaud waters, North Sulawesi, Indonesia. Indonesian Journal of Biotechnology, 24(2), 105-105.

+ Open protocol

+ Expand

RFLP Analysis of ANXA5 Promoter Variant

Check if the same lab product or an alternative is used in the 5 most similar protocols

A restriction fragment length polymorphism (RFLP) analysis targeting the tagSNP 76G/A of the M2 haplotype (rs113588187; Fig 1) was undertaken to confirm the re-sequencing data of the initial Estonian sampleset with an independent method and to further genotype the Danish RPL case-control samples. The ANXA5 promoter region containing the tagSNP 76G/A defining the presence (minor allele A) or absence (major allele G) of M2 risk haplotype was amplified from 50–100 ng of genomic DNA using primers PCRII_fw (5’-CGACCACTCACCCAGACTGT-3’) and PCRII_rev (5’-GGAGACCAACTGGGACGA-3’; S1 Fig) and HOT FIREPol DNA Polymerase (Solis Biodyne). The PCR product (294 bp) was subjected to RFLP analysis using BamHI restriction enzyme (Thermo Scientific, USA) that exhibits no sensitivity to DNA methylation and specifically cuts in case of the major allele G at position 76 (Fig 1E; S1 Fig).

Nagirnaja L., Nõmmemees D., Rull K., Christiansen O.B., Nielsen H.S, & Laan M. (2015). Annexin A5 Promoter Haplotype M2 Is Not a Risk Factor for Recurrent Pregnancy Loss in Northern Europe. PLoS ONE, 10(7), e0131606.

+ Open protocol

+ Expand

RNA Pull-Down and Mass Spectrometry

Check if the same lab product or an alternative is used in the 5 most similar protocols

The pcDNA3.1-GAS5-sense and pcDNA3.1-GAS5-antisense constructs were linearized by digestion with the BamHI restriction enzyme (FD0054, Thermo Scientific, Waltham, Massachusetts), and in vitro transcription was then performed using a mMESSAGE mMACHINE™ T7 Transcription Kit (AM1344, Invitrogen, Waltham, Massachusetts). Transcribed RNAs were purified by a MEGAclear™ Transcription Clean-Up Kit (AM1908, Invitrogen, Waltham, Massachusetts) and were then biotin-labeled with a Pierce™ RNA 3’ End Desthiobiotinylation Kit (20163, Thermo Scientific, Waltham, Massachusetts). RNA pull-down was performed using a Pierce™ Magnetic RNA-Protein Pull-Down Kit (20164, Thermo Scientific, Waltham, Massachusetts). Briefly, labeled RNAs were captured by magnetic beads in a capture buffer with rotation at room temperature for 30 min. Then, prepared cell lysates were rotated with RNA-magnetic bead complexes in RNA-protein binding buffer at 4 °C for 60 min. After washing 3 times, the precipitated products were eluted in an elution buffer and subjected to mass spectrometry analysis or western blot analysis.

Wang Z., Luo J., Huang H., Wang L., Lv T., Wang Z., Li C., Wang Y., Liu J., Cheng Q., Zuo X., Hu L., Ye M., Liu H, & Song Y. (2024). NAT10-mediated upregulation of GAS5 facilitates immune cell infiltration in non-small cell lung cancer via the MYBBP1A-p53/IRF1/type I interferon signaling axis. Cell Death Discovery, 10, 240.

+ Open protocol

+ Expand

Cloning and Expression of SOD Enzyme

Check if the same lab product or an alternative is used in the 5 most similar protocols

pET15b plasmid (Novagen, USA) was digest with BamHI restriction enzyme (Thermo, USA) first to get the linear DNA product. The target gene was amplification using PCR with 2 × Taq Plus MasterMix (CWBIO, China). Both the linearized plasmid and PCR product were loaded to an agarose gel for separation, Gel bands of correct size were cut out. A gel DNA recovery step was performed with a GeneJet Extraction and DNA Cleanup Micro Kit (Thermo, USA). The linearized pET15b and SOD gene was mix and treated by an In-Fusion HD Cloning Kit (Takara, Japan) to ligate them. The recombinant plasmid was confirmed by Sanger sequencing and then transformed into E. coli ER2566 by heat shock method. This engineered strain was cultured in LB medium and induced to express the target gene by IPTG induction. Subsequently, all bacteria cells was collected and disrupted by sonication. The SOD activity was tested using a commercial kit (Beyotime, China).

Lin J., Jiang W., Chen L., Zhang H., Shi Y., Liu X, & Cai W. (2021). Metagenomic sequencing revealed the potential of banknotes as a repository of microbial genes. BMC Genomics, 22, 173.

+ Open protocol

+ Expand

Ty1 RNA Transcription from Plasmid

Check if the same lab product or an alternative is used in the 5 most similar protocols

pBDG433, which contains full-length Ty1 DNA under the control of the SP6 promoter, was digested with BamHI restriction enzyme (Thermo Scientific) to generate a linear sense-strand template for transcription in vitro. DNA was phenol–chloroform extracted, ethanol precipitated and resuspended in 20 μl of water. Ty1 RNA was synthetized using MEGAscript™ SP6 Transcription Kit (Invitrogen) and recovered by LiCl precipitation overnight at –20°C, and then washed twice in 70% ethanol. Purified RNA was resuspended in 30 μl of water. The integrity of the RNA was determined by high-resolution gel electrophoresis (1.5% agarose gel with formaldehyde). RNA was stored at −20°C.

Andrzejewska A., Zawadzka M., Gumna J., Garfinkel D.J, & Pachulska-Wieczorek K. (2021). In vivo structure of the Ty1 retrotransposon RNA genome. Nucleic Acids Research, 49(5), 2878-2893.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!