The RT-qPCR reaction was carried out using 3 μL of isolated viral RNA, which was reverse transcribed and amplified in a 10 μL reaction containing 1 × GoScript ™ RT Mix for 1-Step RT-qPCR, 1× GoTaq Probe qPCR Master Mix with dUTP, 300 nM specific probe labeled with 6-carboxyfluorescein (FAM) and 6-carboxytetramethylrhodamine (TAMRA) (5′ FAM–CGG CAT ACA GCA TCA GGT GCA TAG GAG-TAMRA-3′), and 450 nM of each primer (5′ TTG GTC ATG ATA CTG CTG ATT GC 3′ and 5′ CCT TCC ACA AAG TCC CTA TTG C 3′). The reaction was carried out in a thermal cycler (CFX96 Touch Real-197 Time PCR Detection System, Bio-Rad) under the following conditions: 45 °C 15 min (reverse transcription), 95 °C 2 min, then 40 cycles of 15 s at 95 °C and 30 s at 60 °C. Appropriate standards were prepared to evaluate the number of viral RNA molecules in the sample.
Gotaq probe 1 step rt qpcr system protocol kit
The GoTaq® Probe 1-Step RT-qPCR System Protocol kit is a reagent kit for reverse transcription and real-time quantitative PCR (RT-qPCR) analysis. The kit provides components necessary for the detection and quantification of RNA targets.
Lab products found in correlation
3 protocols using gotaq probe 1 step rt qpcr system protocol kit
Viral RNA Extraction and Quantification
The RT-qPCR reaction was carried out using 3 μL of isolated viral RNA, which was reverse transcribed and amplified in a 10 μL reaction containing 1 × GoScript ™ RT Mix for 1-Step RT-qPCR, 1× GoTaq Probe qPCR Master Mix with dUTP, 300 nM specific probe labeled with 6-carboxyfluorescein (FAM) and 6-carboxytetramethylrhodamine (TAMRA) (5′ FAM–CGG CAT ACA GCA TCA GGT GCA TAG GAG-TAMRA-3′), and 450 nM of each primer (5′ TTG GTC ATG ATA CTG CTG ATT GC 3′ and 5′ CCT TCC ACA AAG TCC CTA TTG C 3′). The reaction was carried out in a thermal cycler (CFX96 Touch Real-197 Time PCR Detection System, Bio-Rad) under the following conditions: 45 °C 15 min (reverse transcription), 95 °C 2 min, then 40 cycles of 15 s at 95 °C and 30 s at 60 °C. Appropriate standards were prepared to evaluate the number of viral RNA molecules in the sample.
Viral RNA Isolation and RT-qPCR Detection
available RNA isolation kit (Viral DNA/RNA Isolation Kit, A&A
Biotechnology, Poland) was used to isolate viral RNA according to
the manufacturer’s protocols using KingFisher Flex Purification
System (Thermo Fisher). The GoTaq Probe 1-Step RT-qPCR System Protocol
kit was used for reverse transcription (RT) and quantitative real-time
PCR (RT-qPCR) isolated RNA (Promega, Madison). Because highly charged
polymers have been shown to impact the RNA isolation process, the
supernatants were diluted 1000-fold before isolation.28 (link) The RT-qPCR reaction was carried out with 3 μL of
isolated viral RNA, which was reverse transcribed and amplified in
a 10 μL reaction containing 1× GoScript TM RT Mix for 1-Step
RT-qPCR, 1× GoTaq Probe qPCR Master Mix with dUTP, 300 nM specific
probe labeled with 6-carboxyfluorescein (FAM), and 6-carboxytetramethylrhodamine
(5′ FAM-CGG CAT ACA GCA TCA GGT GCA TAG GAG-TAMRA-3′)
and 450 nM of each primer (5′ TTG GTC ATG ATA CTG ATT GC 3′
and 5′ CCT TCC ACA AAG TCC CTA TTG C 3′). The following
settings were used to run the reaction in a thermal cycler (Bio-CFX96
Rad’s Touch Real-197 Time PCR Detection System): 15 min at
45 °C (reverse transcription), 2 min at 95 °C, and then
40 cycles of 15 s at 95 °C and 30 s at 60 °C. To determine
the number of viral RNA molecules in the sample, appropriate standards
were prepared.
SARS-CoV-2 RNA Extraction and Detection
of viral RNA was performed automatically using the MagnifiQ 96 Pathogen
instant kit (A&A Biotechnology, Poland) and the KingFisher Flex
System (Thermo Fisher Scientific, Poland), following the manufacturer’s
protocol. The isolated RNA was then processed through reverse transcription
(RT) and quantitative real-time PCR (RT-qPCR) using the GoTaq Probe
1-Step RT-qPCR System Protocol kit (Promega, USA). Given the potential
impact of highly charged polymers on the RNA isolation process, the
supernatants were diluted 1000 times before isolation.
The one-step
RT-qPCR reaction used 3 μL of the isolated viral RNA in a 10
μL reaction volume. This reaction mix contained 1 × GoScript
TM RT Mix for 1-Step RT-qPCR, 1 × GoTaq Probe qPCR Master Mix
with dUTP, a 300 nM specific probe labeled with FAM and TAMRA (5′-FAM–CGGCATACAGCATCAGGTGCATAGGAG–TAMRA-3′),
and 450 nM of each primer (5′-TTGGTCATGATACTGCTGATTGC-3′
and 5′-CCTTCCACAAAGTCCCTATTGC-3′). The process was performed
in a thermal cycler (CFX96 Touch Real-Time PCR Detection System, Bio-Rad)
with the following conditions: 45 °C for 15 min for reverse transcription,
95 °C for 2 min, followed by 40 cycles of 15 s at 95 °C
and 30 s at 60 °C. Appropriate standards were used to determine
the number of viral RNA molecules in the sample.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!