Gotaq probe 1 step rt qpcr system protocol kit

Isolation of viral RNA was carried out using a commercially available RNA isolation kit (Viral DNA/RNA Isolation Kit, A&A Biotechnology, Poland) according to the protocol provided by the manufacturer. Isolated RNA was subjected to reverse transcription (RT) and quantitative real-time PCR (RT-qPCR) using the GoTaq^® Probe 1-Step RT-qPCR System Protocol kit (Promega, Madison, WI, USA). Due to the well-known ability of highly charged polymers to affect the RNA isolation process, the supernatants were diluted 1000-fold prior to isolation [28 (link)].
The RT-qPCR reaction was carried out using 3 μL of isolated viral RNA, which was reverse transcribed and amplified in a 10 μL reaction containing 1 × GoScript ™ RT Mix for 1-Step RT-qPCR, 1× GoTaq Probe qPCR Master Mix with dUTP, 300 nM specific probe labeled with 6-carboxyfluorescein (FAM) and 6-carboxytetramethylrhodamine (TAMRA) (5′ FAM–CGG CAT ACA GCA TCA GGT GCA TAG GAG-TAMRA-3′), and 450 nM of each primer (5′ TTG GTC ATG ATA CTG CTG ATT GC 3′ and 5′ CCT TCC ACA AAG TCC CTA TTG C 3′). The reaction was carried out in a thermal cycler (CFX96 Touch Real-197 Time PCR Detection System, Bio-Rad) under the following conditions: 45 °C 15 min (reverse transcription), 95 °C 2 min, then 40 cycles of 15 s at 95 °C and 30 s at 60 °C. Appropriate standards were prepared to evaluate the number of viral RNA molecules in the sample.

A commercially
available RNA isolation kit (Viral DNA/RNA Isolation Kit, A&A
Biotechnology, Poland) was used to isolate viral RNA according to
the manufacturer’s protocols using KingFisher Flex Purification
System (Thermo Fisher). The GoTaq Probe 1-Step RT-qPCR System Protocol
kit was used for reverse transcription (RT) and quantitative real-time
PCR (RT-qPCR) isolated RNA (Promega, Madison). Because highly charged
polymers have been shown to impact the RNA isolation process, the
supernatants were diluted 1000-fold before isolation.^{28 (link)} The RT-qPCR reaction was carried out with 3 μL of
isolated viral RNA, which was reverse transcribed and amplified in
a 10 μL reaction containing 1× GoScript TM RT Mix for 1-Step
RT-qPCR, 1× GoTaq Probe qPCR Master Mix with dUTP, 300 nM specific
probe labeled with 6-carboxyfluorescein (FAM), and 6-carboxytetramethylrhodamine
(5′ FAM-CGG CAT ACA GCA TCA GGT GCA TAG GAG-TAMRA-3′)
and 450 nM of each primer (5′ TTG GTC ATG ATA CTG ATT GC 3′
and 5′ CCT TCC ACA AAG TCC CTA TTG C 3′). The following
settings were used to run the reaction in a thermal cycler (Bio-CFX96
Rad’s Touch Real-197 Time PCR Detection System): 15 min at
45 °C (reverse transcription), 2 min at 95 °C, and then
40 cycles of 15 s at 95 °C and 30 s at 60 °C. To determine
the number of viral RNA molecules in the sample, appropriate standards
were prepared.

The isolation
of viral RNA was performed automatically using the MagnifiQ 96 Pathogen
instant kit (A&A Biotechnology, Poland) and the KingFisher Flex
System (Thermo Fisher Scientific, Poland), following the manufacturer’s
protocol. The isolated RNA was then processed through reverse transcription
(RT) and quantitative real-time PCR (RT-qPCR) using the GoTaq Probe
1-Step RT-qPCR System Protocol kit (Promega, USA). Given the potential
impact of highly charged polymers on the RNA isolation process, the
supernatants were diluted 1000 times before isolation.
The one-step
RT-qPCR reaction used 3 μL of the isolated viral RNA in a 10
μL reaction volume. This reaction mix contained 1 × GoScript
TM RT Mix for 1-Step RT-qPCR, 1 × GoTaq Probe qPCR Master Mix
with dUTP, a 300 nM specific probe labeled with FAM and TAMRA (5′-FAM–CGGCATACAGCATCAGGTGCATAGGAG–TAMRA-3′),
and 450 nM of each primer (5′-TTGGTCATGATACTGCTGATTGC-3′
and 5′-CCTTCCACAAAGTCCCTATTGC-3′). The process was performed
in a thermal cycler (CFX96 Touch Real-Time PCR Detection System, Bio-Rad)
with the following conditions: 45 °C for 15 min for reverse transcription,
95 °C for 2 min, followed by 40 cycles of 15 s at 95 °C
and 30 s at 60 °C. Appropriate standards were used to determine
the number of viral RNA molecules in the sample.