Plko 1 vector

ALPL was amplified form human genomic DNA by PCR in order to construct a lentiviral vector expressing the human ALPL. The PCR product was digested with BamH I and Xho I restriction enzymes, inserted into the pLenti 6.3 vector (Invitrogen, USA), named pLenti-ALPL. For downregulated ALPL, shRNA sequences targeting to human ALPL were inserted into pLko.1 vector (Invitrogen, USA). To produce lentivirus, 293T cells were co-transfected with the transfer vector and two packaging vectors (i.e., psPAX2 and pMD2.G). Subsequently, the virus was purified using ultracentrifugation. hBMMSCs were plated in 75cm² cultured bottles and transducted with lentiviral constructs and 5 µg/mL polybrene (Sigma, USA, 107689). Primers used to construct the lentiviral vectors of ALPL are listed in supplementary Table 1.

Wild-type mouse GCN5 was amplified by PCR. NotI and KpnI were used to digest the amplicons before inserted into the Pent3c lentiviral vector. The sequences of the primers were: forward: CGGGGTACCATGGCGGAACCTTCCCAGGC; reverse: AAGGAAAAAAGCGGCCGCGGGACCAGGCTCAGGATGCTCA. The primers for GCN5 shRNA were: forward: CCGGGCTACCTACAAAGTCAATTATCTCGAGATAATTGACTTTGTAGGTAGCTTTTTG; reverse: AATTCAAAAAGCTACCTACAAAGTCAATTATCTCGAGATAATTGACTTTGTAGGTAG.
Restriction enzymes AgeI and EcoRI were used to digest the PCR product before incorporated into the PLKO.1 vector (Invitrogen). Sanger sequencing was performed to verify the inserted fragments. To produce the lentivirus, 293T cell line was co-transfected with two packaging vectors (psPAX2 and pMD2.G) and two plasmid vectors. To get rid of the cell debris, supernatant was centrifuged at 1000 rpm for 10 min, followed by filtered through a 0.45-μm polyethersulfone low protein-binding filters. The titer of the lentivirus was 105 IFU/ml, assessed by a quantify kit (Clontech, CA). In all, 8 mg/ml polybrene (Sigma, St. Louis, MO) were used when virus was transfected into BMSCs. A vector inserted with scrambled GCN5 was used as a negative control.

A lentiviral system was used to construct cell lines with stable knockdown and overexpression. shRNAs targeting EHF, GLI1, and CCL2 were inserted into the PLKO.1 vector (Invitrogen) to construct knockdown plasmids. Plasmids was extracted by using a Steadypure Plasmid DNA Extraction Kit (Accurate Biotechnology (Hunan)Co., Ltd) following the manufacturer's instructions. A non‐specific scramble shRNA sequence was used as negative control. The shRNA sequences can be found in Table S2. EHF was also inserted into the plenti vector (Invitrogen) to construct overexpression plasmids. All the above plasmids were confirmed by DNA sequencing. Lentivirus‐infected stable cell lines were screened with puromycin (5 μg/mL) for 2 days.

As described previously [18 (link)], lentivirus vectors were generated in 293 T cells by triple transfection with the vector of interest, psPAX2, and pMD2.G. Infected cells were selected using puromycin (1 μg/mL) or blasticidin (3 μg/mL) as appropriate. shRNA were delivered in the pLKO.1 vector (Open Biosystems). shRNA sequences are as follows: PDLIM7 (GCGAGACTATGAGAAGATGTT and CGTCTGTGCGATATGTCAGAT), CREBBP (CCCGATAACTTTGTGATGTTT and GCTATCAGAATAGGTATCATT), NEDD4-1 (GCCTTTCTCTTGCCTGCATAT and CGGTTGGAGAATGTAGCAATA), PKCD (CGGCATGAATGTGCACCATAA and CAGAGCCTGTTGGGATATATC), and P300 (CCAGCCTCAAACTACAATAAA and CCCGGTGAACTCTCCTATAAT). To rescue knockdown, cells were infected with a lentivirus encoding His-Biotin tagged PDLIM7 with a mismatched sequence.

Plasmids encoding short hairpin RNA (shRNA) sequences for Shh (Clone IDTRCN0000033304), Hhat shRNA 1 (Clone ID TRCN0000035600) and Hhat shRNA 2 (Clone ID TRCN0000035601), cloned into the pLKO.1 vector, were purchased from Open Biosystems (Lafayette, CO). Control pLKO.1 vector, carrying a scrambled shRNA sequence, as well as pHRD8.2 and pCMV VSV-G plasmids, were gifts from Dr. Filippo Giancotti (Memorial Sloan Kettering Cancer Center, New York, NY). The pLenti6/V5-GW/lacZ vector was purchased from Invitrogen (Carlsbad, CA).

shRNA were delivered in the pLKO.1 vector (Open Biosystems) and infected cells selected using puromycin (1μg/ml); infection with a virus carrying a scramble control (CAACAAGATGAAGAGCACCAA) was used as a control in all experiments utilizing shRNA. Cell lines were treated with PD0339221 or shRNA directed against CDK4 (GAGATTACTTTGCTGCCTTAA), MDM2 (M376, TTCACTATTCCACTACCAAAG; M380, TACTAGAAGTTGATGGCTGAG), CDK6 (GACCTGGAAAGGTGCAAAGAA), or ATRX (588, GCCTGCTAAATTCTCCACATT; 590, CGACAGAAACTAACCCTGTAA) for 48 hours to 7 days.
To rescue the MDM2 knockdown we infected cells with a lentivirus (pLOC, Open Biosystems) encoding either an MDM2 expression cassette containing a mismatched sequence (ACTATTCTCAACCCTCAACTTCTA) or an RFP cassette. 24 hours later after transduction, positive cells were selected in media containing 3μg/ml blasticidin and selection was maintained throughout the experiment. Five days after blasticidin selection began we transduced the cells with a second lentiviral vector encoding either the shM380 sequence targeting MDM2 or a scrambled sequence (shSCR) as described above. 24 hours later these cells were selected in media containing both blasticidin and 3μg/ml puromycin.

shRNA were delivered in the pLKO.1 vector (Open Biosystems) and infected cells selected using puromycin (1 μg/ml); infection with a virus carrying a scramble control (5′-CAACAAGATGAAGAGCACCAA-3′) was used as a control in all experiments utilizing shRNA. shRNA for MDM2 (380, 5′-TACTAGAAGTTGATGGCTGAG-3′) and ATRX (588, 5′-GCCTGCTAAATTCTCCACATT-3′; 590, 5′-CGACAGAAACTAACCCTGTAA-3′ were previously characterized^{35 (link)}. Lentiviral vectors targeting HRAS were made with the following sequences (265, 5′-CGGAAGCAGGTGGTCATTGAT-3′; 266, 5′-GTGTGTGTTTGCCATCAACAA-3′),