λ exonuclease

T4 DNA polymerase and T4 polynucleotide kinase (T4 PNK) were purchased from Fermentas. Pfu DNA polymerase was purchased from Sangon Biotech. Phusion DNA polymerase and λ exonuclease were purchased from New England Biolabs. Competent DH5α cells were prepared by the transformation and storage solution [15 (link)] or purchased from Beijing CoWin Bioscience.

Total DNA was isolated with DNAzol from dividing cells according to the manufacturer’s instructions with addition of proteinase K treatment step as described previously [60 (link)]. Nascent strands isolation and λ-exonuclease treatment were performed as described previously [60 (link)]. DNA was layered onto neutral 5 to 30% sucrose gradient prepared in TEN300 (10 mM Tris-HCl, pH 7.9, 2 mM EDTA, 300 mM NaCl) and centrifuged in a Beckman SW41 Ti rotor at 24000 rpm, 4°C, for 22 h. Fractions were withdrawn from the top of the gradient and a small aliquot of each fraction was run on a 1.2% alkaline agarose gel at 50 V overnight at 4°C. Fractions corresponded to 750–1500 bp were pooled and precipitated with ethanol. Before λ-exonuclease treatment, DNA was phosphorylated with T4 polynucleotide kinase (PNK) (NEB) in 1 × PNK buffer at 37°C for 1 h. After phosphorylation, DNA was precipitated with ethanol. Digestion was performed with 100 U of λ-exonuclease (Fermentas) in 1 × λ-exonuclease buffer at 37°C overnight. After digestion, DNA was extracted once with phenol/chloroform/isoamylalcohol and once with chloroform/isoamylalcohol and then precipitated with ethanol. T4 PNK phosphorylation and λ-exonuclease digestion were performed twice, after final purification SNS were resuspended in water and analyzed by real-time PCR.

As above except using 5′ phosphorylated and (AC)₅ version of reverse primer (RP_P, ACACACACACCGGAATTCGGAGCGCGCGCGCGGCATCGC) and forward primer (FP). The results of the two reactions are a DNA fragment in which one stand in each reaction is 5′ phosphorylated and has an (AC)₅ tail, while the other strand is not phosphorylated and has a 3′ (GT)₅ tail.
The PCR reactions were purified using the PCR purification kit from Qiagen. The sense reactions and antisense reactions were pooled separately and 200 μL of each pool mixed with 20 μL 10X λ exonuclease buffer (New England Biolabs, Ipswich, MA, USA) and 20 U λ exonuclease, and incubated at 37° for two hours. This allowed only the phosphorylated 5′ end strand to be degraded. The resulting two single strands were gel purified. The sense and anti-sense strands were mixed 1:1 and annealed at 95°C for five minutes and then cooled to room temperature over the course of an hour. To ensure the duplex promoter was formed the digested sense, anti-sense, and annealed DNA were run on a 2% agarose gel. Once the annealed product was confirmed the DNA was concentrated using a 3 kDa MWCO centrifuge filter (Millipore, Billerica, MA, USA) at 4°C. OD₂₆₀ was taken to calculate the concentration using the following equation: $\left(OD260\mathrm{nm}\right)\times \left(\mathit{dilution}\mathit{factor}\right)\times 50\mathrm{\mu g}/\mathrm{ml}=\mathrm{D}\mathrm{N}\mathrm{A}\left(\mathrm{\mu g}/\mathrm{ml}\right)$