Nextera xt v2 barcoded primers

Fungal ITS1–2 regions were amplified by PCR using the following primers: ITS1F CTTGGTCATTTAGAGGAAGTAA; ITS2R GCTGCGTTCTTCATCGATGC. Primers were modified to include forward (5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG‐[locus-specific sequence]) and reverse (5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG‐[locus-specific sequence]) sequencing adaptors. ITS1–2 amplicons were generated with 35 cycles using Invitrogen AccuPrime PCR reagents (Carlsbad, CA). In a second PCR reaction, amplicons from each sample were uniquely indexed using Illumina Nextera XT v2 barcoded primers (San Diego, CA). 2×300 paired end sequencing was performed on an Illumina MiSeq platform (Illumina, CA) using the following PCR protocol: Initial denaturation at 94^oC for 10 min, followed by 40 cycles of denaturation at 94^oC for 30 sec, annealing at 55^oC for 30 sec, and elongation at 72^oC for 2 min, followed by an elongation step at 72^oC for 30 min. Quality control of all libraries were conducted by qPCR, DNA 1000 Bioanalyzer (Agilent), and Qubit (Life Technologies) to validate and quantify library construction prior to preparing a Paired End flow cell. Analysis was performed as in our recent studies (13 (link), 16 ).