Total genomic DNA was isolated from 46 cultivars of chestnuts using a DNeasy Plant Mini kit (Qiagen, Germany) and the cetyltrimethylammonium bromide (CTAB) method, with minor modifications. PCR amplification was performed in a 20 µL volume using Taq DNA polymerase (RBC bioscience, Taiwan). The genotyping PCRs for this experiment used individual SNP primers, listed in Supplementary Table S7 . PCR conditions were as follows: 94 °C for 3 min; 40 cycles at 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 30 s; and extension at 72 °C for 5 min (BIO-RAD T100, USA). The PCR products were sequenced by the Sanger method from forward or reverse primers. The sequences were aligned with their respective chromatograms using the BioEdit software v.7.2.548 .
Taq dna polymerase
Manufactured by RBC Bioscience
Sourced in India
Taq DNA polymerase is a thermostable DNA polymerase enzyme isolated from the thermophilic bacterium Thermus aquaticus. It is a core component in the Polymerase Chain Reaction (PCR) technique, a widely used method for the amplification of DNA sequences.
Automatically generated - may contain errors
4 protocols using taq dna polymerase
1
Chestnut Cultivar Genotyping Protocol
2
Molecular Detection of Helicobacter pylori
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
vacA of H. pylori was amplified by semi-nested PCR using specific primers, vac F1/F2 and R1 followed by vac F1/F2 and R2 (Table 1 ). PCR was performed in a total volume of 25 μl containing 500 ng DNA template, 1X PCR buffer (+ 1.5 mM MgCl2), 0.4 μM of each primer, 0.5 unit of Taq DNA polymerase (RBC bioscience, Taipei, Taiwan) and 0.2 mM dNTP (Amresco, Ohio, USA) using a thermal cycler (C1000™ Thermal Cycler, BioRad). PCR conditions and primer sequences are shown in Table 1 . Amplified products were separated by electrophoresis in a 1.5% agarose gel and visualized by staining with ethidium bromide.
Primer sequences and PCR conditions for molecular detection of H. pylori
| Genes | Primer names: sequences (5′ > 3′) | Product size (bp) | PCR conditions | Ref. |
|---|---|---|---|---|
| vacA | F1/2: GCATGATTTTGGCACCATTG | 429 | 95 °C 30 s, 52 °C 30 s, | [21 ] |
| R1: TTTTCATATTTAGGGGCAAA | 72 °C 45 s (35 cycles) | |||
| F1/2: GCATGATTTTGGCACCATTG | 276 | 95 °C 30 s, 62 °C 30 s, | ||
| R2: ATCGCATTGCTCAAGCTCAA | 72 °C 45 s (35 cycles) | |||
| 16S rRNA | F: CTCATTGCGAAGGCGACCT | 139 | 95 °C 20 s, 58 °C 30 s, | [43 (link)] |
| R: TCTAATCCTGTTTGCTCCCCA | 72 °C 45 s (35 cycles) |
3
Aminoglycoside Resistance Gene Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Detection of aminoglycoside resistance genes rrs (rrs1 and rrs2), aacC2 (aacC1-1, aacC1-2, aacC2-1, aacC2-2, aacC3-1, aacC3-2, aacC4-1, aacC4-2, aadC-1, and aadC-2), aacA-aphD (aacA-aphD-1 and aacA-aphD-2), and aphA3 (aphA3-1 and aphA3-2) from E. coli was done by PCR technique using Thermal Cycler (PTC 150, MJ Research). Blue mix DNA polymerase master mix, deoxynucleotide triphosphates (dNTPs), taq DNA polymerase, and the reaction buffer containing magnesium ions and the other required components were obtained from RBC Bioscience, India. Primers for the genes were purchased from Invitrogen (USA) through JOYVEL Biotech, India. Template DNA was isolated from E. coli. The working concentration of the primer was taken as 200 mM. The amount of PCR reaction mixture was taken as 50 μL which included 25 μL of blue mix DNA master mix, 5 μL of forward primer, 5 μL of reverse primer, 5 μL of template DNA, and 10 μL of TAE buffer. The PCR was performed with initial denaturation at 95°C for 3 min followed by 32 cycles each of denaturation at 94°C for 30 sec, annealing at 60°C for 45 sec, and extension at 72°C for two min for each gene.
The amplification products were analyzed by 0.8% agarose gel electrophoresis and the product size was compared with DNA markers. After treatment with ethidium bromide (0.5 μg/mL), the gels were visualized using gel-doc system (Bio-Rad Laboratories, USA).
The amplification products were analyzed by 0.8% agarose gel electrophoresis and the product size was compared with DNA markers. After treatment with ethidium bromide (0.5 μg/mL), the gels were visualized using gel-doc system (Bio-Rad Laboratories, USA).
4
DNA Extraction and COI Amplification in Larval Fish
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A total of 106 genomic DNA samples from representative larval fish were extracted from muscle tissues using proteinase K digestion followed by the standard phenol chloroform method (Sambrook & Russell, 2001) . The quality of the extracted DNA was determined on a 1% agarose gel. The fragments of the COI gene were amplified with four primers (FishF1, FishF2, FishR1, and FishR2) that were described by Ward et al. (2005) (link) using PCR. A total volume of 25 l of a PCR mixture contained 1× Taq buffer, 2.5 mM MgCl2, 0.4 M of each primer, 1 M dNTPs, 0.625 U of Taq DNA polymerase (RBC Bioscience Corp., New Taipei, Taiwan) and 50-100 ng of the extracted DNA. The thermal conditions included initial denaturation for 2 min at 95C followed by 35 cycles of denaturation for 30 sec at 94C, annealing for 30 sec at 54C, extension for 1 min at 72C and an extension for 10 min at 72C. The PCR products were visualized by 1% agarose gel electrophoresis under UV light.
The amplified PCR products were purified with the HiYield ™ Gel/PCR DNA Fragments Extraction kit (RBC Bioscience) according to the manufacturer's instructions. All purified PCR products were sequenced in one direction with the FishF1/FishF2 primers complementary to the 5' ends of the COI gene fragments by Macrogen Inc. in South Korea.
The amplified PCR products were purified with the HiYield ™ Gel/PCR DNA Fragments Extraction kit (RBC Bioscience) according to the manufacturer's instructions. All purified PCR products were sequenced in one direction with the FishF1/FishF2 primers complementary to the 5' ends of the COI gene fragments by Macrogen Inc. in South Korea.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!