Taq dna polymerase
Taq DNA polymerase is a thermostable DNA polymerase enzyme isolated from the thermophilic bacterium Thermus aquaticus. It is a core component in the Polymerase Chain Reaction (PCR) technique, a widely used method for the amplification of DNA sequences.
4 protocols using taq dna polymerase
Chestnut Cultivar Genotyping Protocol
Molecular Detection of Helicobacter pylori
Primer sequences and PCR conditions for molecular detection of H. pylori
Genes | Primer names: sequences (5′ > 3′) | Product size (bp) | PCR conditions | Ref. |
---|---|---|---|---|
vacA | F1/2: GCATGATTTTGGCACCATTG | 429 | 95 °C 30 s, 52 °C 30 s, | [21 ] |
R1: TTTTCATATTTAGGGGCAAA | 72 °C 45 s (35 cycles) | |||
F1/2: GCATGATTTTGGCACCATTG | 276 | 95 °C 30 s, 62 °C 30 s, | ||
R2: ATCGCATTGCTCAAGCTCAA | 72 °C 45 s (35 cycles) | |||
16S rRNA | F: CTCATTGCGAAGGCGACCT | 139 | 95 °C 20 s, 58 °C 30 s, | [43 (link)] |
R: TCTAATCCTGTTTGCTCCCCA | 72 °C 45 s (35 cycles) |
Aminoglycoside Resistance Gene Detection
The amplification products were analyzed by 0.8% agarose gel electrophoresis and the product size was compared with DNA markers. After treatment with ethidium bromide (0.5 μg/mL), the gels were visualized using gel-doc system (Bio-Rad Laboratories, USA).
DNA Extraction and COI Amplification in Larval Fish
The amplified PCR products were purified with the HiYield ™ Gel/PCR DNA Fragments Extraction kit (RBC Bioscience) according to the manufacturer's instructions. All purified PCR products were sequenced in one direction with the FishF1/FishF2 primers complementary to the 5' ends of the COI gene fragments by Macrogen Inc. in South Korea.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!