The total RNA samples were extracted from cells or tumor tissues using the Trizol reagent (Roche, IN, USA). Total RNA for 500 ng was reverse transcribed to cDNA using Reverse Transcription Master Kit (Toyobo, Osaka, Japan) according to the manufacturer's instructions. Real-time PCR was performed on ABI 7500 fast system (Applied Biosystems, CA, USA) using SYBR Green I (Toyobo, Osaka, Japan). The sequences of the primer pairs are as follows. Caspase-1: Forward 5’-ACACGTCTTGCCCTCATTATCT-3’, Reverse 5’-ATAACCTTGGGCTTGTCTTTCA-3’; GAPDH : Forward 5’-ATCACTGCCACCCAGAAGAC-3’, Reverse 5’-TTTCTAGACGGCAGGTCAGG-3’. GAPDH served as an internal control. The relative quantification of gene expression was determined using the 2-ΔΔCT method.
Reverse transcription master kit
Manufactured by Toyobo
Sourced in Japan
The Reverse Transcription Master Kit is a laboratory equipment designed for the synthesis of complementary DNA (cDNA) from RNA templates. It contains all the necessary components, including reverse transcriptase enzyme, buffer, and primers, to efficiently convert RNA into cDNA for further downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Sybr green 1, by Toyobo (3 mentions)
Abi 7500 fast system, by Thermo Fisher Scientific (3 mentions)
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Trizol reagent, by Roche (1 mentions)
Prism v5, by GraphPad (1 mentions)
Sybr green 1 master mix, by Roche (1 mentions)
Lightcycler 480 instrument, by Roche (1 mentions)
4 protocols using reverse transcription master kit
1
Caspase-1 Expression Quantification
2
RNA Extraction and Quantitative PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA samples were extracted from cells or tumor tissues using TRIzol reagent (Invitrogen) according to the manufacturer’s directions. Total RNA for 2 μg was reverse transcribed to cDNA using the Reverse Transcription Master Kit (Toyobo, Osaka, Japan).
Equal amounts of cDNA were subjected to PCR with the condition including an initial denaturation at 94°C for 5 min, followed by 40 cycles of 94°C for 30 s, 54°C for 30 s, 72°C for 30 s, and a terminal extension at 72°C for 5 min. After the reaction, 10 μl of the PCR products was used for running in agarose gels, stained with ethidium bromide, and visualized using UV transillumination.
Real-time (RT)-PCR was performed on ABI 7500 fast system (Applied Biosystems, Foster City, CA, USA) using SYBR Green I (Toyobo). Each sample was examined in triplicate, and β-actin was used as the internal control. The relative quantification of gene expression was determined using the 2−ΔΔCT method. GraphPad Prism v5 (GraphPad Software, San Diego, CA, USA) was used to create scatter plots.
Equal amounts of cDNA were subjected to PCR with the condition including an initial denaturation at 94°C for 5 min, followed by 40 cycles of 94°C for 30 s, 54°C for 30 s, 72°C for 30 s, and a terminal extension at 72°C for 5 min. After the reaction, 10 μl of the PCR products was used for running in agarose gels, stained with ethidium bromide, and visualized using UV transillumination.
Real-time (RT)-PCR was performed on ABI 7500 fast system (Applied Biosystems, Foster City, CA, USA) using SYBR Green I (Toyobo). Each sample was examined in triplicate, and β-actin was used as the internal control. The relative quantification of gene expression was determined using the 2−ΔΔCT method. GraphPad Prism v5 (GraphPad Software, San Diego, CA, USA) was used to create scatter plots.
3
Quantifying miRNA Expression in Cardiac Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA samples were isolated from cultured NRVCs and cardiac tissues using trizol reagent (Invitrogen, Carlsbad, California, USA) according to manufacturer's protocol. The relative expression levels of miRNAs were quantified by the Reverse Transcription Master Kit (Toyobo, Osaka, Japan) and real-time RT-PCR with SYBR Green I (Toyobo, Osaka, Japan). cDNA was amplified in an ABI 7500 fast system (Applied Biosystems, CA, USA), using the same cycling parameters as follows: 95°C for 10 min followed by 40 cycles of a three-stage temperature profile of 95°C for 15 sec and 60°C for 15 sec, then 72°C for 30 sec. Sequences of gene-specific PCR primers were used as follows: miR-16: RT: 5′- GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCGCCAAT-3′. Forward: 5′- GGGGTAGCAGCACGTAAAT -3′, Reverse: 5′- TGTCGTGGAGTCGGCAATTG -3′, U6: Forward: 5′- GCTT CGGC AGCA CATA TACT AAAA T-3′, Reverse: 5′- CGCT TCAC GAAT TTGC GTGT CAT-3′. U6 was used as an internal control for measurement.
4
Quantitative Gene Expression Analysis by Real-Time PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted by TRIzol Reagent (Invitrogen, USA) and reverse transcribed to cDNA using Reverse Transcription Master Kit (Toyobo, Japan) according to the manufacturer’s instructions. Real‐time polymerase chain reaction was performed on LightCycler@480 Instrument (Roche, Swiss) using SYBR Green I Master mix (Roche, Swiss). The relative gene expression levels were determined using the 2−△△CT method using TBP (Tata‐binding protein) as an internal control. The primer sequences are listed in Table S3 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!