Single and double ISH were performed as previously described (Genikhovich and Technau, 2009a (link); Moran et al., 2013 (link)). dFISH was performed also according to published protocols (Nakanishi et al., 2012 (link); Wolenski et al., 2013 (link)) with tyramide conjugated to Dylight 488 and Dylight 594 fluorescent dyes (Thermo Fisher Scientific). In ISH and FISH, embryos older than 4 days were treated with 2 u/µl T1 RNAse (Thermo Fisher Scientific) after probe washing in order to reduce background. Stained embryos and larvae were visualized with an Eclipse Ni-U microscope equipped with a DS-Ri2 camera and an Elements BR software (Nikon, Tokyo, Japan). For each gene at least 20 specimens from each developmental stage were tested.
Elements br software
Manufactured by Nikon
Sourced in Japan
Nikon Elements BR software is a data analysis and visualization tool designed for microscopy imaging. It provides a platform for managing, processing, and analyzing digital images captured using Nikon microscopes and cameras.
Automatically generated - may contain errors
Lab products found in correlation
Ds ri2 camera, by Nikon (3 mentions)
Eclipse ni u microscope, by Nikon (3 mentions)
Rnase t1, by Thermo Fisher Scientific (2 mentions)
Eclipse e400 microscope, by Nikon (2 mentions)
Background sniper, by Biocare Medical (2 mentions)
Goat on rodent hrp polymer, by Biocare Medical (2 mentions)
Immpact dab peroxidase substrate, by Vector Laboratories (2 mentions)
Diva decloaker, by Biocare Medical (2 mentions)
Digital sight ds fi2 camera, by Nikon (2 mentions)
Anti ciap1 antibody, by R&D Systems (2 mentions)
Eclipse ci microscope, by Nikon (2 mentions)
Smz18, by Nikon (1 mentions)
Cfi plan apo 10 0, by Nikon (1 mentions)
Cfi plan fluor 40 0, by Nikon (1 mentions)
Ds fi3 color camera, by Nikon (1 mentions)
9 protocols using elements br software
1
In Situ Hybridization Protocol for Embryos
2
Transgenic Line with memOrange2 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For generating a transgenic line expressing memOrange2 under the native regulatory region of NvNcol-3, we microinjected a Nematostella zygote with a mixture that included guide RNA (250 ng/μl) of the sequence CAGUAGUUAGGGCAUCCCGG (as part of a transcript also carrying a tracrRNA), Cas9 recombinant protein with nuclear localization signal (500 ng/μl; PNA Bio, USA), and a donor plasmid that includes two homology arms (spanning positions 1,380,459-1,381,924 and 1,381,925-1,383,035 in scaffold 23 of the N. vectensis genome) spanning the memOrange2 gene. This construct encodes a chimeric protein sequence that carries the first 32 amino acids of NvNcol-3, fused to the memOrange2 sequence, separated by a flexible linker sequence of 2 × (Gly-Gly-Ser) to allow proper folding of the fluorescent protein. The expression of the transgene in injected zygotes and embryos was monitored under a Nikon SMZ18 fluorescent stereomicroscope equipped with a Nikon Ds-Qi2 monochrome camera and Elements BR software (Nikon, Japan).
3
Visualizing Single Cells with Microscopy
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Single cells were visualized with an Eclipse Ni-U microscope equipped with a DS-Ri2 camera and Elements BR software (Nikon). After tissue dissociation, the cells were laid on positively charged glass slides (Bar Naor Ltd., Petah Tikva, Israel). Pictures were edited with Photoshop and all manipulations were performed evenly on photographs and no manipulations were made to enhance unevenly part of any picture.
4
In situ Hybridization for Cnidarian Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ISH was performed as previously described (Genikhovich and Technau 2009b (link)). Embryos older than 4 d were treated with 2 u/µL T1 RNAse (Thermo Fisher Scientific) after probe washing in order to reduce background. Stained embryos and larvae were visualized with an Eclipse Ni-U microscope equipped with a DS-Ri2 camera and an Elements BR software (Nikon). For each gene, at least 20 individuals from each developmental stage were tested. The specificity of the NveMAC1 probe was confirmed by performing ISH on 4 dpf animals that were injected with either control shRNA or shRNA to knockdown MAC1. This was repeated and the ratio of stained animals was compared.
5
Nikon Eclipse E400 Microscopy Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Microscopy was performed using a Nikon Eclipse E400 microscope using the CFI Plan Achromat Series objectives for phase contrast. Images were obtained using a high‐definition Nikon DS‐Fi1 camera head and processed using the Nikon Elements Br software (Nikon), as previously described (Elliott et al., 2012 (link)).
6
Immunohistochemical Analysis of cIAP1 in BLT Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tissues for immunohistochemical analysis were harvested from BLT mice and fixed in 10% formalin for 16 to 24 h at 4°C. Samples were then embedded in paraffin, cut into 5-μm sections, and mounted onto poly-L-lysine–coated glass slides. Following paraffin removal, antigen retrieval (DIVA Decloaker, Biocare Medical), and blocking of nonspecific Ig-binding sites (Background Sniper, Biocare Medical), tissue sections were stained with anti-cIAP1 antibody (R&D Systems) overnight at 4°C. To detect cIAP1, sections were probed with a goat-on-rodent HRP-polymer (Biocare Medical) and developed with diaminobenzidine (ImmPact™ DAB Peroxidase Substrate, Vector Laboratories). As an isotype control, tissue sections were stained with polyclonal goat IgG (R&D Systems) negative control antibodies. Tissue sections were imaged with a Nikon Eclipse Ci microscope using Nikon Elements BR software (version 4.30.01) and a Nikon Digital Sight DS-Fi2 camera.
7
Bright-Field and Polarized Light Microscopy
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bright‐field and polarized light micrographs were captured on a Nikon Eclipse E400 microscope using a Nikon DS‐fi3 color camera. Objectives used: Nikon CFI Plan Apo 4×/0.20, Nikon CFI Plan Apo 10×/0.45, Nikon CFI Plan Apo 20×/0.75, and Nikon CFI Plan Fluor 40×/0.75. LUTs were adjusted to improve structural visualization. Post processing was performed in Nikon Elements BR software.
8
Immunohistochemical Analysis of cIAP1 in BLT Mice
9
Morphological Analysis of Ceratomyxa thymalli Spores
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mature spores from infected gall bladders were fixed in glycerol and gelatin as a slide preparation according to the procedure described by Donec & Shulman (1973) . On average, 50 spores were measured using the dimensions recommended by Lom & Arthur (1989) (link) with Nikon-Elements BR software. All measurements are given in micrometers (µm) and data presented as mean ± SD, with the range in parentheses. Statistical data were treated with Student's t-test (Sokal & Rohlf 1981) . Statistical significance was established at p < 0.05.
A comparative morphological analysis was performed between spores from the above samples and those from T. baicalensis collected in Chivyrkui Bay (53°46' N, 109°2' E) in 2017 and stored in the laboratory collection.
For histology, the gall bladders of 2 T. nigrescens infected by C. thymalli were fixed in 4% formalin, embedded in paraffin, sectioned, stained with hematoxylin and eosin (H&E), and then examined and photographed.
A comparative morphological analysis was performed between spores from the above samples and those from T. baicalensis collected in Chivyrkui Bay (53°46' N, 109°2' E) in 2017 and stored in the laboratory collection.
For histology, the gall bladders of 2 T. nigrescens infected by C. thymalli were fixed in 4% formalin, embedded in paraffin, sectioned, stained with hematoxylin and eosin (H&E), and then examined and photographed.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!