The largest database of trusted experimental protocols

Lentiviral plko 1 empty vector

Manufactured by Horizon Discovery

The Lentiviral pLKO.1 Empty Vector is a plasmid-based tool commonly used in gene knockdown experiments. It serves as a backbone for the delivery of short hairpin RNA (shRNA) sequences, enabling targeted gene silencing in a variety of cell types.

Automatically generated - may contain errors

2 protocols using lentiviral plko 1 empty vector

1

Lentiviral-mediated TGF-β1 Knockdown in BM-MSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lentiviral-mediated short-hairpin RNA (shRNA) was used for stable knockdown of TGF-β1 in human BM-derived MSCs. shRNA lentiviral vectors (NM_000660, XM_011527242; Clone ID: TRCN0000003318; Sequencing Primer: 5'—AAACCCAGGGCTGCCTTGGAAAAG—3'; Vector Map: pLKO.1) were purchased from GE Healthcare Dharmacon, Inc. (Lafayette, CO). Lentiviral pLKO.1 Empty Vector (Cat# RHS4080, GE-Dharmacon) was used as control. HEK293T cells were transfected with each TGF-β1 shRNA construct along with packaging vectors pMD2.G (0.5 μg) and psPAX2 (1.5 μg) (Addgene, Inc., Watertown, MA) using Jet Prime Reagent (Polyplus-transfection®, Illkirch-Graffenstaden, France) according to the manufacturer’s guidelines. The medium containing lentivirus was collected 72 hours after transfection and incubated with BM-MSC cells for 24 hours. The transduced cells were selected using puromycin (0.5 μg/mL) for 3 days, and TGF-β1 mRNA and protein knockdown efficacy was determined by quantitative polymerase chain reaction (qPCR) or Western blotting, respectively. The plasmid TRCN0000003318 (RHS4533-EG7040, GE-Dharmacon) provided the best knockdown efficacy.
+ Open protocol
+ Expand
2

Lentiviral-Mediated TGF-β1 Knockdown in MSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lentiviral-mediated short-hairpin RNA (shRNA) was used for stable knockdown of TGF-β1 in human BM-derived MSCs. shRNA lentiviral vectors (NM_000660, XM_011527242; Clone ID: TRCN0000003318; Sequencing Primer: 5' -AAACCCAGGGCTGCCTTGGAAAAG -3';
Vector Map: pLKO.1) were purchased from GE Healthcare Dharmacon, Inc. (Lafayette, CO). Lentiviral pLKO.1 Empty Vector (Cat# RHS4080, GE-Dharmacon) was used as control.
HEK293T cells were transfected with each TGF-β1 shRNA construct along with packaging vectors pMD2.G (0.5 µg) and psPAX2 (1.5 µg) (Addgene, Inc., Watertown, MA) using Jet Prime Reagent (Polyplus-transfection ® , Illkirch-Graffenstaden, France) according to manufacturer's guidelines. The medium containing lentivirus was collected 72 hours after transfection and incubated with BM-MSC cells for 24 hours. The transduced cells were selected using puromycin (0.5 µg/mL) for 3 days, and TGF-β1 mRNA and protein knockdown efficacy was determined by quantitative polymerase chain reaction (qPCR) or western blotting, respectively. The plasmid TRCN0000003318 (RHS4533-EG7040, GE-Dharmacon) provided the best knockdown efficacy.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!