Liposome 2000

MG132 and Liposome 2000 were obtained from Sigma (Shanghai, China). Immunohistochemical kits were obtained from ZSGB-Bio (Beijing, China). Antibodies against HECTD3 (11487-1-AP), CDK2 (10122-1-AP), CDK4 (11026-1-AP), Tubulin (11224-1-AP), HA-tag (51064-2-AP), p21 (10355-1-AP) and C-MYC (10828-1-AP) were bought through Proteintech. HECTD3 antibody (bs-15448R) was obtained from Bo Aosen Biotechnology Co., Ltd (Beijing, China) for immunohistochemistry (IHC). Antibodies Flag and Ki67 antibodies were obtained through Sigma-Aldrich (Shanghai, China).

PcDNA3.1 expression vector encoding short-hairpin RNA (shRNA1 or shRNA2) targeting hsa_circ_0018818 or a non-targeted sequence (negative control) were obtained from GenScript Co., Ltd (Nanjing, China). NSCLC cells were then transfected with the vector using Liposome 2000, after which the transfectants were selected by incubation in the presence of G418 (Sigma Aldrich, St. Louis, MO, USA). RT-qPCR was used to verify the transfection efficiency. The shRNA sequences were as follows: hsa_circ_0018818 shRNA1, 5’-CTTCCCACAGTTTTGCTCTG-3’ (forward) and AAAACTTCCCACAGTTTTG (reverse); hsa_circ_0018818 shRNA2, 5’-CAGTTTTGCTCTGCAGACGG-3’ (forward) and AAAAACAGTTTTGCTCTGCA (reverse).
In addition, NCI-H1650 cells were transfected with miR-767-3p agonist, miR-767-3p antagonist or negative control (NC) RNAs (GenePharma, Shanghai, China) using Lipofectamine 2000 as previously described [35 (link)]. The transfection efficiency was determined using q-PCR.