The mRNA expression of PPARγ was measured by RT-PCR analysis. The primer was purchased from Sangon Biotech Co., Ltd (Shanghai, China). Total RNA was extracted from the cultured cells using Trizol reagent and quantified using a Nano Photometer (Thermo Scientific, MA, USA). PrimeScript™ RT Master Mix (Takara, Beijing, China) was used to reverse-transcribe 400 ng of RNA into cDNA. The RT-PCR system consisted of 10 μL TB Green Premix Ex Taq II (Takara, Beijing, China), 0.8 μL upstream and downstream primers, 0.4 μL ROX Reference Dye II (Takara, Beijing, China), 2 μL template cDNA, and 6 μL DEPC water (Takara, Beijing, China). The reaction conditions were 95 °C for 30 s, 40 cycles of 95 °C for 5 s and 60 °C for 30 s. The expression level of the PPARγ gene was calculated by the 2−△△Ct method using the housekeeping gene 18S rRNA as the reference. The primer sequences are listed in Table 1 .
Primer sequences used for RT-PCR analysis
| Forward primer (5′–3′) | Reverse primer (5′–3′) | |
|---|---|---|
| PPARγ | GTGAAGGGCAAGCCACTCTG | AGAGAGGGTCCCATTTCCGA |
| 18S rRNA | CAGCCACCCGAGATTGAGCA | TAGTAGCGACGGGCGGTGTG |