Flag pcdna3

The human ERα cDNA was amplified by PCR using primers: forward 5′-TTGGATCCATGACCATGACCCTCCACACCAA-3′ and reverse 5′-TCGAATTCTCATTTATCGTCATCGTCTTTGTAGTCGACCGTGGCAGGGAAACCCTC -3′ (reverse primer contains the flag sequence in bold). PCR program was as follows: 95 °C for 60 sec, 59 °C for 60 s, and 72 °C for 90 s for 35 cycles. Flag-ERα cDNA was cloned into the BamHI and EcoRI site of pcDNA3.1(+) (Invitrogen). Flag-pcDNA3.1(+) without the ERα insert was used as a control (Invitrogen). Flag-ERβ were obtained from Addgene (plasmid #35562). (4 × 10⁷) Ishikawa cells and (4 × 10⁶) SH-SY5Y cells were treated with transfection mix [Lipofectamine 2000 (Invitrogen) mixed with 40 μg of either pcDNA 3.1(+)/Flag-ERα or pcDNA /Flag-ERβ or pcDNA3.1(+)/Flag] for 20 min. Cells were plated into a 15-cm dish and incubated at 37 °C, 5% CO₂ for 6 h. Fresh phenol red-free and serum-free medium were added, and cells were incubated for an additional 12 h, then treated with E₂, E₃, or bisphenol A (1 × 10⁻⁶ M) for 24 h. Cells were lysed, bound cellular proteins were purified using an anti-Flag antibody cross-linked to agarose beads, washed, and eluted with 3xFlag peptide according to the manufacturer’s product manual (Sigma-Aldrich).