Human or mouse myoblast cells were seeded in a 150 mm Petri dish (3000 cells/cm2). After 2 days, total RNA was isolated with RNeasy Mini Kit (Qiagen, Valencia, CA) according to the manufacturer’s instructions. cDNA was obtained using Superscript III cDNA Synthesis Kit (Invitrogen) and was subjected to real-time PCR (1 µg per reaction) using SYBR Green Kit (Bio-Rad, Hercules, CA). Primers for real-time PCR were listed in Supplementary Table 4 . Bio-Rad Software CFX Manager Ver 3.1 was used for qPCR cycle determination.
Sybr green kit
Manufactured by Bio-Rad
Sourced in United States, China, Germany
The SYBR Green kit is a fluorescent dye-based solution designed for use in real-time PCR assays. The dye binds to double-stranded DNA, allowing for the detection and quantification of target DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (29 mentions)
Trizol, by Thermo Fisher Scientific (14 mentions)
Iscript cdna synthesis kit, by Bio-Rad (13 mentions)
Thermocycler, by Bio-Rad (6 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (6 mentions)
Rneasy mini kit, by Qiagen (5 mentions)
Tri reagent, by Molecular Research Center (5 mentions)
Primescript rt kit, by Takara Bio (5 mentions)
Icycler iq real time detection system, by Bio-Rad (4 mentions)
Trizol reagent, by Takara Bio (4 mentions)
Cfx96, by Bio-Rad (4 mentions)
Rneasy kit, by Qiagen (4 mentions)
Icycler, by Bio-Rad (4 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (4 mentions)
Aurum total rna mini kit, by Bio-Rad (3 mentions)
Cfx manager software, by Bio-Rad (3 mentions)
Cfx96 real time system, by Bio-Rad (3 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (3 mentions)
Primescript rt reagent kit, by Takara Bio (3 mentions)
Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (3 mentions)
108 protocols using sybr green kit
1
Myoblast RNA Isolation and qPCR Analysis
2
Quantitative Analysis of IL-17A in Activated CD4+ T Cells
3
Quantitative Real-time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cellular mRNA was purified from the mock and experimentally treated OE cells using the RNeasy mini kit (Qiagen, Valencia, CA), according to the manufacturer's instruction. During purification, all RNA samples were treated with RNase-free DNase I (Qiagen, Valencia, CA) to remove genomic-DNA contamination. The RNA was quantitated using a Nanodrop spectrophotometer (ND-1000; Thermo Scientific, Rockford, IL), and subjected to cDNA synthesis using the iSCript cDNA synthesis kit (Invitrogen; Grand Island, NY). Quantitative real-time PCR (qPCR) was performed using an ABI 7000 thermal cycler (Bio-Rad, Hercules, CA) following cDNA synthesis. Specific primers for the iScript RT-PCR were used with SYBR Green kit (Bio-Rad, Hercules, CA) according to the manufacturer's protocol. Optimized primer pairs were either designed by using the Primer 3 design tool [20 ], or created using previously published primer sequences for the specified gene. The specific primer pairs (Invitrogen, Carlsbad, CA) for targeting specific genes are listed in Table 1
4
qRT-PCR Quantification of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The assay of qRT-PCR was performed as previously described (20 (link)). Briefly, total RNA was extracted from the cultured bEnd.3 cells (2×105 cells/ml) using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's instructions. RNA was reverse transcribed using, and qPCR was performed with an ABI 9700 PCR Thermal Cycler and an SYBR-Green kit (Bio-Rad Laboratories, Inc., Hercules, CA, USA) according to the manufacturer's instructions. Briefly, qRT-PCR was performed using 10 µP 2X SYBR-Green PCR Master Mix (Toyobo Life Science, Osaka, Japan), with 5 µl of cDNA, 0.5 µl of primers and 4 µN of RNase-free ddH2O contained in 20 µl of reaction mixture. The reaction was performed with one cycle of 95°C for 5 min and 40 cycles of 95°C for 15 sec, 65°C for 15 sec and 72°C for 35 sec in ABI 7300 real-time PCR instrument (Applied Biosystems; Thermo Fisher Scientific, Inc.). When the reaction proceeded. Ct value was obtained, and results were analyzed using 2−∆∆Cq calculation (20 (link)). β-actin was used to normalize the data. The primer sequences were: β-actin forward, 5′-CATTGCTGACAGGATGCAGA-3′ and reverse, 5′-CTGCTGGAAGGTGGACAGTGA-3′; PPARγ forward, 5′-GGAAGACCACTCGCATTCCTT-3′ and reverse, 5′-GTAATCAGCAACCATTGGGTCA-3′; BIRC5 forward, 5′-GAGGCTGGCTTCATCCACTG-3′ and reverse, 5′-ATGCTCCTCTATCGGGTTGTC-3′. β-actin was used as an internal control.
5
Identification and Characterization of AREB/ABF Genes in Grape
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In order to identify the V. vinifera AREB/ABF genes, protein sequences of A. thaliana AREB/ABF genes were used for a BLASTP search against the V. vinifera genome. The bZIP domain was checked in all the grape candidates. All known AREB/ABF gene sequences in the NCBI (http://ncbi.nlm.nih.gov ) database along with A. thaliana genes and grape candidates were clustered (S2 Fig ), and based on their classification in the cluster, four grape AREB/ABF candidate genes were selected. DREB/CBF genes were identified from V. vinifera genome based on their annotation against the NCBI database. Primers were designed for each of the genes using Primer 3 (http://bioinfo.ut.ee/primer3 ) and NCBI primer blast (http://www.ncbi.nlm.nih.gov/tools/primer-blast ). For family gene distinction, one of the primer pairs was designed from the bZIP domain and the other one was designed from the conserved sequences of the particular gene. Details of the primers are provided in Table 1 . Quantitative real time PCR (qRT-PCR) reactions were performed using SYBR Green kit (Bio-rad, Hercules, CA). Reactions were performed in a 20 μl volume containing 3 μl of diluted cDNA (5 times diluted from the first strand cDNA stock) and 10 μl 2× iQ SYBR Green Master Mix Supermix as described earlier [39 (link)]. Elongation factor (VvEF1α; accession no. LOC100261589) was used as the internal reference gene (S3 Fig ).
6
Characterization of Stemness and EMT Markers
7
Total RNA Extraction and Quantitative PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ovules and seeds used for total RNA extraction were frozen in liquid nitrogen immediately after harvest and stored at −80°C prior to extraction. Four independent biological samples were used for each analysis. Each replicate comprised the content in ovules/seeds of 10 to 15 pistil/siliques. Total RNA was extracted using the RNeasy Mini kit (Qiagen), including RNase-Free DNase Set (Qiagen) treatment during washing, according to the manufacturer’s instructions, and subsequently stored at −80°C. The Superscript Reverse Transcriptase II kit (Invitrogen) was used to generate cDNA from 1 µg of total RNA. Each cDNA sample was diluted 1:125 in water. Quantitative PCRs were performed with the SYBR Green kit (Bio-Rad) on a Bio-Rad CFX real-time PCR machine. For each reaction, 4.4 µL of diluted cDNA were added to 5 µl of SYBR Green and to 0.3 µl of each primer (10 µM) (Supplemental Table 2
8
Phytochemical Regulation of OCTN2 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SW480 cells were seeded in a 6-well plate at a density of 5 × 105 cells/well and exposed to potent activators from phytochemicals at various concentrations (0, 5, 10, 20, or 40 μM) for 48 h at 37°C. Only DMSO (v/v 0.1%) was added to control cells. DMEM medium containing phytochemicals or DMSO was renewed every 24 h. In the antagonist assay, 20 μM phytochemicals plus a range of concentrations of GW9662 (5, 10, or 20 μM) was incubated with SW480 cells for 48 h. Cells were washed twice by PBS, and total mRNA was extracted by TRIzol reagent (Takara). Two micrograms total RNA was reverse transcribed to cDNA following the manufacturer’s instructions of the first strand cDNA synthesis kit (Takara). The level of OCTN2 mRNA was determined by quantitative RT-PCR using a SYBR Green Kit (Bio-Rad, Hercules, CA, USA). The primers were the following: OCTN2, F: 5′-CCATTGTGACCGAGTGGAACC-3′, R: 5′-ACATTCTTCCGGCCAAACCTG-3′ and β-actin, F: 5′-TTGCCGACAGGATGCAGAAGGA-3′, R: 5′-AGGTGGACAGCGAGGCCAGGAT-3′. The PCR conditions included the following steps: initial denaturation at 95°C for 2 min, followed by 40 cycles at 95°C for 15 s, 60°C for 15 s, and 72°C for 30 s. The relative mRNA levels of OCTN2 were normalized to β-actin and quantitated by the 2–ΔΔCt method (Livak and Schmittgen, 2001 (link)).
9
Quantitative PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol (Invitrogen) was used to extract RNA, and 1 µg of RNA was then reverse transcribed into cDNA using a PrimeScript™ RT kit (Takara) according to the instructions. A SYBR Green kit and CFX96 real-time fluorescent quantitative PCR (qPCR) detection system (Bio-Rad, Richmond, CA, USA) were used for qPCR with 18S rRNA as the internal reference. The 2-ΔΔCt method was used to calculate the relative expression levels of the target genes. The forward primer for 18S rRNA was 5'-AGGCCCTGTAATTGGAATGAGTC-3'; the reverse primer for 18S rRNA was 5'- GCTCCCAAGATCCAACTACGAG-3'. The forward primer for HMGCL was 5'-TCAGCACCTCATCTATGGGCA-3'; the reverse primer for HMGCL was 5'-GGAACCCACTTAGGAGACACAAA-3'. The forward primer for IL8 was 5'-TTTTGCCAAGGAGTGCTAAAGA-3'; the reverse primer for IL8 was 5'-AACCCTCTGCACCCAGTTTTC-3'.
10
Quantification of Kidney Fibrosis Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol RNA isolation reagent (Thermo Fisher Scientific) was added to the subset of cryogenically preserved kidney tissue. The samples were incubated (3 min) with chloroform and centrifuged (13.000 rpm; 10 min, 4 °C). The supernatant was isolated and RNA was precipitated using isopropanol (20 min, RT) and centrifuged (13.000 rpm; 10 min, 4 °C). The obtained pellet was washed with 75% ethanol and centrifuged (13.000 rpm; 10 min, 4 °C). Thereafter, the pellet was dried, dissolved in nuclease-free water and incubated for 10 min at 60 °C. The RNA concentration and quality was determined with a Nanodrop spectrophotometer (Thermo Scientific). Total RNA was reverse-transcribed with AMV-RT (Roche). The RT-PCR was performed with a SYBR Green kit (Bio-Rad) on a CFX96 RT-PCR Detection System (Bio-Rad). Primers used for detection of mouse fibronectin were GGCAGGCTCAGCAAATCG (forward) and CATAGCAGGTACAAACCAGGG (reverse), and for detection of mouse collagen IV CGTCTCTGCTGGTCCCCT (forward) and GGCAAGCCTCTTTCTCCCTT (reverse). mRNA expression of genes of interest was compared to mRNA expression of housekeeping genes (HPRT and GAPDH).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!