Ad gfp

Mandibles of E15.5 wild-type (WT) embryos were dissected in Hanks Balanced Salt Solution (HBSS, Sigma-Aldrich) and cultured in osteogenic medium containing β-glycerophosphate (8 mM; Sigma-Aldrich) and l-ascorbic acid phosphate (50 μg/ml; Wako), or in osteogenic medium supplemented with 10 ng/ml of VEGF164. Medium was replaced twice during the culture period. The mandibles were harvested on day 7 and subjected to Alizarin Red and Alcian Blue staining. Mandibular ossification was analyzed and quantified as described above. The entire experiment was repeated once and consisted of a total of 10 control and 10 VEGF164 treated mandibles.
Mandibles of E15.5 Vegfa^fl/fl embryos were dissected in HBSS and infected with either Ad-Cre or Ad-GFP (Vector Biolabs) for 24 h followed by culture in osteogenic medium. Protein was harvested from mandibles after 4 day culture for VEGF ELISA and Western Blotting analysis. Additional mandibles were infected with Ad-Cre and cultured in osteogenic medium (n = 3) or in osteogenic medium supplemented with 10 ng/ml of VEGF164 (n = 3). After 7 days of culture, the mandibles were subjected to Alizarin Red and Alcian Blue staining, and mandibular ossification was analyzed.

Adenoviral vector expressing short hairpin RNA (shRNA) targeting human TRAF3IP2 (ad.TRAF3IP2 shRNA) was custom generated at Vector Biolabs (Malvern, PA). Ad.GFP (#1060, Vector Biolabs) served as a non-targeting control. For adenoviral transduction, cells were traduced with adenoviral vectors at moi10 for 1 h in basal medium and then switched to complete medium for 24 h. Lentiviral vectors expressing shRNA targeting human NLRP3 (Product type: SHCLNV-NM_004895, TRC# TRCN0000432208; Target sequence: CCGGGTGGATCTAGCCACGCTAATGCTCGAGCA TTAGCGTGGCTAGATCCACTTTTTTG) and SGLT2 (SLC5A2; Product type: SHCLNV-NM_003041, TRC# TRCN0000043603, Target sequence: CGGGCATATTTCCT GCTGGTCATTCTCGAGAATGACCAGCAGGAAATATGCTTTTTG) were purchased from Millipore-Sigma. Lentiviral shRNA targeting p65 subunit of NF-κB (#sc-29410-V) and c-Jun subunit of AP-1 (#sc-29223-V) were purchased from Santa Cruz Biotechnology, Inc., and have all been previously described ([11 (link)]). For lentiviral infection, SMC at 50–60% confluency were infected with the indicated shRNA at a multiplicity of infection (moi) of 0.5 for 48 h in complete media. To increase transfection efficiency, cells were cotreated with Polybrene® (5 μg/ml in water), a cationic polymer. Neither adenoviral or Lentiviral shRNA nor Polybrene® modulated SMC adherence, shape, or viability (trypan blue-dye exclusion; data not shown).

Briefly, the NP tissue organs were isolated from the NP region of IVDs in the spinal column from the first lumbar spine to the tenth tail region (23 (link)). The dissected NP tissues were briefly rinsed in sterile PBS and immediately placed in 6-well cell culture plates containing culture medium (10% FBS in αMEM with penicillin and streptomycin). NP tissues from IFT80^fl/fl mice were infected with adenovirus (Ad) either Cre (Ad-CMV-Cre, #1405, Vector Biolabs) or GFP (Ad-GFP, #1060, Vector Biolabs) for 24 h as described in (12 (link)). The deletion efficiency of IFT80 was confirmed by RT-PCR analysis.
For OAF cell culture, the OAF was isolated as described previously (24 (link)). In brief, OAF tissues were digested initially with protease (53702–25KU, EMD Millipore) for 1 h with agitation on a shaker, followed by collagenase-P (11213865001, Sigma-Aldrich) for another 12 h at 37 °C. The digested cells were washed twice with PBS and cultured in DMEM (Gibco) supplemented with 10% FBS and 1% penicillin–streptomycin to 80%–90% confluence at 37 °C and 5% CO₂. OAF cells from IFT80^fl/fl mice were infected with Adenovirus-Cre (Ad-Cre) as described previously to delete IFT80 gene, and cells infected with Adenovirus-GFP (Ad-GFP) served as a control (12 (link)).