We genotyped four polymorphic microsatellite markers (Lr2, Lr6, Lr7 and Lr9) as described by Hale et al. [44 ], in two sets of two marker multiplex PCR amplifications, for a subset of 117 samples (including 27 samples from Hume–Whittlesea). The microsatellite loci chosen for this study had previously been developed and successfully genotyped for L. raniformis around Melbourne [44 ]. Three markers incorporated a GTTTCTT ‘pigtail’ added to the 5′ end of the reverse primer to reduce variation in stutter (Lr2, Lr6 and Lr9). See Hale et al. [44 ] for methods for fluorescently labelling fragments for all loci. The PCR was performed in a 10 μl total volume with 1 μl of DNA template (neat), 5 μl GoTaq Hot Start Polymerase (Promega) (25 mM MgCl2, GoTaq Hot Start Polymerase, 5× Colourless GoTaq Flexi Buffer, 5× Green GoTaq Flexi Buffer), 0.5 μM reverse primer, 0.15 μM forward primer, 0.25 μM fluorescently labelled 454A primer and 3.1 μl dH2O. Amplification involved 95°C 2 min, 42 cycles of 95°C 30 s, 50°C 45 s, 72°C 45 s, followed by 72°C 5 min (adapted from Hale et al. [44 ]). Fragment analysis of PCR products were carried out by Macrogen on an Applied Biosystems ABI3730XL DNA analyser using a LIZ-500 size standard. Scoring was completed using Geneious Pro v. 5.6, and all samples were screened manually for accuracy.
Gotaq hot start polymerase
Manufactured by Promega
Sourced in United States, Germany, Switzerland
GoTaq Hot Start Polymerase is a thermostable DNA polymerase designed for use in PCR (Polymerase Chain Reaction) applications. It is engineered to remain inactive at lower temperatures, preventing non-specific amplification and improving PCR specificity and yield.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (6 mentions)
Improm 2 reverse transcription system, by Promega (3 mentions)
Ez dna methylation kit, by Zymo Research (3 mentions)
Qiaquick gel extraction kit, by Qiagen (3 mentions)
Genemapper software, by Thermo Fisher Scientific (3 mentions)
Mgcl2, by Promega (3 mentions)
Qiaamp stool mini kit, by Qiagen (2 mentions)
Wizard genomic dna purification kit, by Promega (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Rneasy plus mini kit, by Qiagen (2 mentions)
Abi prism 3100 genetic analyzer, by Thermo Fisher Scientific (2 mentions)
Dneasy blood and tissue kit, by Qiagen (2 mentions)
Superscript 3, by Thermo Fisher Scientific (2 mentions)
Gotaq flexi buffer, by Promega (2 mentions)
Green gotaq flexi buffer, by Promega (2 mentions)
Quantstudio 3 real time pcr system, by Thermo Fisher Scientific (2 mentions)
Rox reference dye, by Thermo Fisher Scientific (2 mentions)
Sybr green 1 nucleic acid gel stain, by Promega (2 mentions)
Pgem t easy vector, by Promega (2 mentions)
92 protocols using gotaq hot start polymerase
1
Microsatellite Genotyping of L. raniformis
2
Fecal DNA Extraction and PCR Detection of Cryptosporidium
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fecal aliquots without any additive were subjected to PCR test within 2 weeks from storage. DNA samples were isolated and purified using QIAamp® Stool Mini Kit (Qiagen, Hilden, Germany). The extraction procedure was carried out following the changes we have introduced over amended kit's protocol in a previous study [14 (link)]. A specific DNA sequence of the Cryptosporidium oocyst wall protein (COWP) gene was amplified using previously published primers [16 (link)]. Amplification reactions were done using Techne™ TC-4000 thermal cycler. The GoTaq® Hot Start Polymerase (Promega, Heidelberg, Germany) and other reagents were used in PCR with final concentrations closely similar to the published protocol. PCR products were analyzed on 1-2% of agarose gel electrophoresis.
3
Genetic Confirmation of Organoid Recombination
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A small amount of tissue from each mouse was used for genotyping. Confirmation of recombination events upon tamoxifen injection was assessed by genotyping the corresponding organoids that were selected for sequencing. For genotyping, the organoids from one well of a 48-well plate were lysed in 200 μL lysis buffer supplemented with 150 μg Proteinase K and then incubated overnight at 55 °C. The lysates were diluted 10 times with water and subjected to PCR amplification using GoTaq Hot Start Polymerase (M7423, Promega).
The following primers were used for genotyping: for the Cre allele: Cre_Fw (5′-CACCAGCCAGCTATCAACTCG-3′) and Cre_Rev (5′-TTACATTGGTCCAGCCACCAG-3′); for the Apclox allele: Apc_Fw (5′-GTTCTGTATCATGGAAAGATAGGTGGTC-3′) and Apc_Rev1 (5′-CACTCAAAACGCTTTTGAGGGTTGATTC-3′) or Apc_Rev2 (5′-GAGTACGGGGTCTCTGTCTCAGTGAA-3′); for the Tp53lox allele: Tp53_Fw1 (5′-CACAAAAAACAGGTTAAACCCA-3′) or Tp53_Fw2 (5′-AAGGGG TATGAGGGACAAGG-3′) and Tp53_Rev (5′-GAAGACAGAAAAGGGGAGGG-3′); for the LSL-KrasG12D allele: Kras_WT_Fw (5′-TGTCTTTCCCCAGCACAGT-3′) or Kras_MUT_Fw (5′-CCATGGCTTGAGTAAGTCTGC-3′) and Kras_common_rev (5′-CTGCATAGTACGCTATACCCTGT-3’). The PCR conditions and DNA fragment sizes obtained are described in theSupplementary Information section .
The following primers were used for genotyping: for the Cre allele: Cre_Fw (5′-CACCAGCCAGCTATCAACTCG-3′) and Cre_Rev (5′-TTACATTGGTCCAGCCACCAG-3′); for the Apclox allele: Apc_Fw (5′-GTTCTGTATCATGGAAAGATAGGTGGTC-3′) and Apc_Rev1 (5′-CACTCAAAACGCTTTTGAGGGTTGATTC-3′) or Apc_Rev2 (5′-GAGTACGGGGTCTCTGTCTCAGTGAA-3′); for the Tp53lox allele: Tp53_Fw1 (5′-CACAAAAAACAGGTTAAACCCA-3′) or Tp53_Fw2 (5′-AAGGGG TATGAGGGACAAGG-3′) and Tp53_Rev (5′-GAAGACAGAAAAGGGGAGGG-3′); for the LSL-KrasG12D allele: Kras_WT_Fw (5′-TGTCTTTCCCCAGCACAGT-3′) or Kras_MUT_Fw (5′-CCATGGCTTGAGTAAGTCTGC-3′) and Kras_common_rev (5′-CTGCATAGTACGCTATACCCTGT-3’). The PCR conditions and DNA fragment sizes obtained are described in the
4
Ehrlichia Detection via Heminested PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from blood and DH82 cell culture, using the Wizard Genomic DNA purification Kit (Promega, Madison, WI, USA) according to the manufacturer’s instructions. For molecular diagnosis, a heminested PCR protocol was used to amplify a fragment of the Ehrlichia gene dsb. The first PCR reaction targeted 401-bp (primers: Dsb-330 5′ GATGATGTTTGAAGATATSAAACAAAT 3′ and Dsb-720 5′ CTATTTTACTTCTTAAAGTTGATAWATC 3′), and the second reaction targeted 349-bp (primers: Dsb-380 5′ ATTTTTAGRGATTTTCCAATACTTGG 3′ and Dsb-720), as previously reported [9 (link)]. Amplification was carried out by following a protocol involving 1.25 U GoTaq™ Hot Start Polymerase (Promega, Madison, WI, USA) and 10 pmol/µL of each primer, according the manufacturer’s instructions. DNA of E. canis strain Cuiabá#1 and template free reactions were used as positive () and negative controls of the PCR reactions. Amplicons were visualized by agarose gel electrophoresis (1.5%).
5
Temporal Profiling of il1b Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Embryos were collected in triplicate at the indicated times and conditions, n=20 per replicate. Replicates were anesthetized in 0.04% Tricaine, washed with clean egg water in a microfuge tube and RNA extraction using TRIzol (Invitrogen) and chloroform extraction followed by ethanol precipitation. One microgram of total RNA was DNase treated using ezDNase (Invitrogen), followed by synthesis of cDNA using the Superscript IV First-Strand Synthesis System (Invitrogen) with Oligo(dT)20 primers according to the manufacturer's protocol. Each aliquot of cDNA was serially diluted 100-fold for use in RT-PCR. GSP-il1bmat was amplified using the AttB1 Gaussia SP F/AttB2R il1b R primer pair listed above. The expression of actb1 was determined using actb1 F: CCCTCCATTGTTGGACGAC and actb1 R: CCGATCCAGACGGAGTATTTG. The pME:GSP-il1bmat plasmid, linearized at BbsI, was used as a positive control. PCR was performed using GoTaq Hot Start Polymerase (Promega, M5005), with one microliter of diluted cDNA, or 25 picograms of linearized plasmid, per 20 µl reaction. Cycling conditions were: initial denaturation (94°C for 3 min), followed by 35 cycles of denaturation (94°C for 20 s.) annealing (55°C for 20 s.) and extension (72°C for 1 min). This was followed by a final extension (72°C for 5 min) then termination at 4°C. PCR reactions were performed at least three times, representative results are shown.
6
Genetic Disruption of GHR in IECs
7
Transcriptomic Analysis of Tamoxifen-Treated Murine Midbrain
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from dissected midbrains of 18-month-old mice injected with tamoxifen at the age of 12 months and control littermates using the RNeasy Plus Mini kit (Qiagen). Analysis of RNA expression using a custom nCounter CodeSet was carried out in the nanoSTRING nCounter Core Facility of the University College London. The first-strand cDNA for real-time quantitative RT-PCR analysis was synthesized using random primers (Promega) and SuperScriptIII reverse transcriptase (Invitrogen). For PCR amplification reaction Go Taq Hot Start polymerase (Promega), DyNAmo HS SYBR Green supermix, and ROX (Finnzymes) as a passive reference dye, were used. Each sample was analyzed in quadruplicate on an ABI StepOnePlus real-time PCR instrument, and data were analyzed using integrated StepOne Software v2.3 (Applied Biosystems). cDNA amount for each gene was normalized to that of GAPDH. Primer sequences used were as follows: ALDH1a1: 5′- GGCCTTCACTGGATCAACAC-3′ and 5′- GGGTGACTCTCTTCAGATTG-3’; GAPDH: 5′- TCGCCAGCCGAGCCA-3′ and 5′- GAGTTAAAAGCAGCCCTGGTG -3’.
8
Quantitative RT-PCR Analysis of Fusion Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNA was isolated using TRIzol reagent (Invitrogen) and RT-PCR was performed as described previously [31 (link), 32 (link)], using GoTaq DNA polymerase or GoTaq Hot Start polymerase (Promega). The PCR cycle numbers were FLI-1-EWS (40), EWS-FLI-1 (25), FLI-1 (40), EWS (25), and RNA polymerase II (25). The following primers were used (see Figure 1A for the location of primers): FLI-1- EWS #1 5′ primer, AATACAACCTCCCACACCGA, 3′ primer, ACTCCTGCCCATAAACACCC; FLI-1- EWS #2 5′ primer, GTGCTGTTGTCACACCTCAG, 3′ primer, GTTCTCTCCTGGTCCGGAAA; EWS- FLI-1 #3 5′ primer, GCACCTCCATCCTACCCTCCT, 3′ primer, TGGCAGTGGGTGGGTCTTCAT; Fli-1- EWS #4, 5′ primer, ATGGACGGGACTATTAAGGA, 3′ primer, CTCGTCTTCCTCCACCAAAG; Fli-1 #5, 5′ primer, AATACAACCTCCACACCGA, 3′ primer, CTTACTGATCGTTTGTGCCCC; Fli-1- EWS #6, 5′ primer, ATGGACGGGACTATTAAGGA, 3′ primer, GTTCTCTCCTGGTCCGGAAA; Fli-1- EWS #7 5′ primer, GTGCTGTTGTCACACCTCAG, 3′ primer, CTCGTCTTCCTCCACCAAAG; EWS 5′ primer, CAGCCTCCCACTAGTTACCC, 3′ primer, GTTCTCTCCTGGTCCGGAAA; and RNA polymerase II (Pol II) 5′ primer, GGATGACCTGACTCACAAACTG, 3′ primer, CGCCCAGACTTCTGCATGG. The quantitative real-time RT-PCR was performed using GoTaq® qPCR Master Mix (Promega) and 7500 Real-Time PCR System (Applied Biosystems). FLI1-EWS #2 primers were used.
9
MGMT Methylation Analysis by MS-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After DNA modification with Methylamp DNA Modification Kit (Epigentek, Farmingdale, NY, USA), MS-PCR for MGMT were determined as described previously (Martini et al, 2008 (link)). Briefly, bisulphite-modified DNA (100–200 ng) was amplified in a mixture containing 1 × PCR buffer (20 mM Tris (pH 8.3), 50 mM KCl, 1.5 mM MgCl2), deoxynucleotide triphosphates (0.2 mM each), primers (20 pM each) and 0.75 U GoTaq Hot Start polymerase (Promega, Madison, WI, USA) in a final volume of 25 μl. Polymerase chain reaction conditions were: an initial denaturation of 95 °C for 8 min, followed by 35 cycles of 95 °C for 60 s, 60 °C for 60 s and 72 °C for 60 s. Polymerase chain reaction products were electrophoresed in a 2.5% agarose gel, stained with ethidium bromide and visualised under ultraviolet illumination. Methylation-specific-PCR analysis was performed in duplicate for all samples. Normal lymphocyte DNA supermethylated with SssI methyltransferase (New England Biolabs, Beverly, MA, USA) and treated with bisulphite was used as the unmethylated and methylated control, water as a negative control and untreated DNA as an internal PCR control. We also carried out MS-PCR on granulocyte DNA obtained from 10 healthy individuals, as the control group.
10
16S rDNA Sequencing Confirmation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A sequencing analysis was performed to confirm the partial 16S rDNA of the X. taiwanensis strain PLS235 that was detected using only the proposed qPCR assays. Amplicons were created using GoTaq Hot Start polymerase (Promega, Madison, WI, USA) and the primers fD1/rD1 (Table 2 ). They were directly sequenced in both directions on an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA) using a BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems) and the primers fD1/XylR2 (Table 2 ).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!