Celllytic m buffer

Cells were lysed in the Cell Lytic M buffer (Merck/Sigma, Darmstadt, Germany) supplemented with the cOmplete mini protease inhibitor cocktail (Roche). Total protein concentration was measured at 280 nm using the DS-11 Spectrophotometer (DeNovix, Wilmington, DE, USA). Cell lysates were resolved by 8% or 10% SDS-PAGE and transferred to PVDF membrane (Merck Millipore, Burlington, MA, USA), which was subsequently blocked with 5% bovine serum albumin (BSA, Merck/Sigma, Darmstadt, Germany). Primary antibodies were incubated for one hour at room temperature (RT). Goat B1B2 anti-PRV IE180 polyclonal antibody was used at a dilution of 1:5000 (from Dr. Hanns-Joachim Rziha). Mouse anti-PRV gE mAb was diluted at 1:2000. Mouse anti-β-actin monoclonal antibody (Novus Biologicals) was diluted at 1:5000. This was followed by HRP-conjugated secondary antibodies for 1 h at RT. The signal was detected by chemiluminescence using the Clarity Max Western ECL Substrate (Bio-Rad, Hercules, CA, USA) and the Alliance Q9 Mini instrument (Uvitec, Cambridge, UK). Densitometric analysis was performed using the Uvi Band software (Uvitec).

To overexpress Sigmar1, primary NRCs were infected with Sigmar1 carrying adenoviral vector (10 MOI) for 2 hours in DMEM media only (without serum or antibiotics), after which the media were changed to regular culture media. We prepared adenoviral constructs containing wild-type Sigmar1 by cloning into a pShuttle-CMV vector; replication-deficient recombinant adenoviruses were made using the AdEasy system (Agilent Technologies)⁷³ . Plates infected with adenovirus expressing β-galactosidase served as controls for all the experiments.
To knockdown Sigmar1, Sigamr1 siRNA (GGAUCACCCUGUUUCUGACUAUUGU and ACAAUAGUCAGAAACAGGGUGAUCC) (Invitrogen) was transfected into NRC using Lipofectamine 2000 (Invitrogen) in OptiMEM media (Gibco) for 16 hours⁷³ . Media were changed to regular culture media following 16 hours. A non-specific siRNA was used as a negative control in all silencing experiments. After 72 hours of adenovirus infection and siRNA transfection in both Sigmar1 overexpressed and knockdown experiments, NRCs were lysed using Cell Lytic M buffer (Sigma-Aldrich) containing protease and phosphatase inhibitors (Roche) for western blot analyses.

Cells were lysed in cell lytic M buffer (Sigma, St. Louis, USA) supplemented with 0.1% phosphatase-inhibitor (Sigma, St. Louis, MO, USA) and 0.1% protease-inhibitor (Sigma, St. Louis, MO, USA). Isolated proteins (40 μg) were fractioned using 12% SDS gels and electro-transferred to a polyvinylidene difluoride membrane (Merck Millipore, Cork, Ireland). Primary antibodies against S100A4 1:250 (HPA007973; Sigma, St. Louis, USA), CYR61 1:250 (HPA029853; Sigma, St. Louis, MO, USA), YAP 1:250 (sc-398182; Santa Cruz Biotechnology, Dallas, TX, USA), ERK1/2 1:1000 (4695S;Cell Signaling Technologies Inc., Danvers, MA, USA), Phospho-ERK1/2(Thr202/Tyr204) 1:1000 (9101S; Cell Signaling Technologies Inc.), and GAPDH 1:2000 (5174; Cell Signaling Technologies Inc) were used. The membrane was washed and incubated in horseradish peroxidase-conjugated secondary antibodies (GE Healthcare, Buckinghamshire, UK). Antibody-bond protein bands were assayed using a chemiluminescent luminol enhancer solution (Cyanagen, Bologna, Italy).

In Western Blot analysis, cells were lysed in cell lytic M buffer (Sigma) supplemented with 0.1% phosphatase-inhibitor (Sigma) and 0.1% protease-inhibitor (Sigma). Isolated proteins (40 µg) were fractioned using 12% SDS gel and electro-transferred to a polyvinylidene difluoride membrane (Merck Millipore, Cork, Ireland). Primary antibodies against c-Myc 1:10,000 (Abcam, Cambridge, UK) and GAPDH 1:2000 (Cell Signaling, Danvers, MA, USA) were used. The membrane was washed and incubated in horseradish peroxidase-conjugated secondary antibody (GE Healthcare, Buckinghamshire, UK). Antibody-bond protein bands were assayed using a chemiluminescent luminol enhancer solution (Cyanagen, Bologna, Italy). For visualization and quantification, the bands were scanned using a C-DiGit Blot Scanner (LI-COR Biosciences, Lincoln, NE, USA).

In Western Blot analysis, cells were lysed in cell lytic M buffer (Sigma) supplemented with 0.1% phosphatase-inhibitor (Sigma) and 0.1% protease-inhibitor (Sigma). Isolated proteins (40 µg) were fractioned using 12% sodium dodecyl sulfate (SDS) gel and electro-transferred to a polyvinylidene difluoride membrane (Merck Millipore). Primary antibodies against ARHGAP29 1:2000 (#NBP1-05989, Novus Biologicals, Centennial, CO, USA), AKT1 1:1000 (#9272, Cell Signaling, Danvers, MA, USA), pAKT1 1:1000 (#4058, Cell Signaling), and GAPDH 1:2000 (#5174S, Cell Signaling) were used. The membrane was washed and incubated in horseradish peroxidase-conjugated secondary antibody (GE Healthcare, Buckinghamshire, UK). Antibody-bond protein bands were assayed using a chemiluminescent luminol enhancer solution (Cyanagen, Bologna, Italy).

The differentiated cardiomyocytes (day 20, day 40 or day 60) were washed with PBS and lysed with Cell Lytic M Buffer (Sigma, C2978). Samples were diluted 4 times in SDS LB buffer (BIO-RAD) and boiled at 95°C for 10 min 15 μL of samples were loaded in each lane on a Tri-Glycine 4–20% gel (GenScript) and ran for ∼40–75 min at 100–150 V. Gels were either dry transferred onto a membrane using the IBlot system (iBlot2, IB21001) for 4 min at 20 V or wet transferred for 40–60 min at 100 V in transfer buffer containing methanol. Membranes were blocked in Odyssey blocking solution (LI-COR) for 1 h at room temperature. After blocking, the membranes were incubated with primary antibodies (see Antibody Table) overnight while shaking at 4°C. After washing in TBS-T (0.1% tween, Sigma), membranes were incubated with secondary antibodies (see Antibody Table). Blots were visualized using the LI-COR system (LI-COR). All bands of interest were normalised against a loading control (see Antibody Table).