Gdna eliminator column

BM cell suspensions were prepared and immunostained as for FC analysis described above. Cellular populations of interest were sorted using a FACS Aria (BD Biosciences) equipped with 4 lasers. A total of 5000 to 10,000 cells of each endothelial subtype were directly collected in RLT lysis buffer (Qiagen). Genomic DNA (gDNA) was depleted from cellular lysates using gDNA eliminator columns (Qiagen), RNA was extracted using the RNeasy Plus Micro Kit (Qiagen) and complementary DNA (cDNA) was generated with the High-Capacity cDNA Reverse-Transcription Kit (Thermo Scientific), following the manufacturers’ instructions. Gene expression was measured with a 7500 Fast Real-Time PCR System using either TaqMan® probes or Power SYBR® Green. A full list of primer pairs employed for individual gene detection can be found in Supplementary Table 2.

C. amycolatum was cultured in CM9 minimal media with or without supplementation of cyanocobalamin for 48 h, and total RNA was extracted using the Qiagen RNeasy Plus minikit with enzymatic and mechanical lysis. Briefly, cell pellets were resuspended in 100 μl of an enzymatic cocktail containing 50 U/ml lysozyme, 500 U/ml mutanolysin, and 2 mg/ml proteinase K in TE buffer and incubated for 15 min with intermittent vortexing. Cells were then bead beat in 2-ml glass bead tubes (Qiagen) with the kit lysis buffer for 5 cycles of 40-s bead beating on a MP Biomedicals FastPrep-24 5G homogenizer. Tubes were centrifuged at maximum speed, and supernatants were transferred to Qiagen gDNA eliminator columns. Remaining steps were carried out according to manufacturer protocol. cDNA was synthesized from total RNA with the SuperScript IV VILO Master Mix with ezDNase Enzyme (Invitrogen) following the manufacturer’s protocol. RT-PCR was performed using the PowerUP SYBR green Master Mix (Applied Biosystems) on a QuantStudio 7 Flex real-time PCR system (Applied Biosystems) using the primers listed in Supplemental Material S10. Results were normalized to those obtained from the 16S rRNA gene using TaqMan probe Ba04230899_s1.

Briefly, approximately 500,000 CD4 + IL2RA + cells were sorted from CD4-enriched splenocytes and total RNA was isolated from samples using the RNeasy Micro Kit (QIAGEN) according to the manufacturer’s instructions with the following options: cells were pelleted and resuspended in RLT buffer with β-mercaptoethanol and homogenized using QIAshredder (QIAGEN). DNA removal was performed with gDNA Eliminator Columns (QIAGEN). RNA samples were analyzed with a NanoDrop spectrophotometer and all samples had a 260/280 ratio of 1.80 or higher. RNA integrity was measured by Bioanalyzer and all samples had an RNA integrity score (RIN) of 8.0 or more. RNA-seq libraries were prepared by the Functional Genomics Laboratory at Berkeley. RNA samples were poly-A selected and then converted into sequencing libraries with the ultra-low input SMART-seq kit. The samples were pooled and sequenced on one lane of the Illumina HiSeq4000. Il2ra isoform analysis was done using the UNIX grep command to identify reads in raw fastq that contained sequences for the E2–E2 junction (ACCAGCAACTAACTGTGTCT) or E2–E3 junction (ACCAGCAACTCCCATGACAA). Read counts were normalized to the total number of reads for a given sample. Short reads were also aligned with STAR to the mouse mm10 reference. Differential expression analysis was performed using EdgeR from Bioconductor Package for R^{14 (link)}.

For RNA-seq and validation experiments, cells were fractionated and cytoplasmic and nuclear RNA were isolated using the PARIS Kit (Ambion) to enrich for the respective RNA species. gDNA was depleted on gDNA eliminator columns (QIAGEN) and RNA was purified with the RNeasy Mini kit (QIAGEN). For DTT and arsenite experiments, total RNA was isolated using TRIzol LS.