At the end of experiments, the lenses (n = 3 per group) were washed with PBS and lysed in RIPA buffer containing protease inhibitors (Aidlab Biotechnologies, Beijing, China) for 30 min on ice. The lens lysates were centrifuged at 12,000×g for 20 min at 4 °C, and the proteins were quantified using the BCA kit. Protein samples (80 μg) were separated by 10% sodium dodecylsulfate-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membranes (Millipore, Billerica MA, USA). The membranes were blocked with 5% fat-free dry milk for 2 h and then incubated with a rabbit polyclonal antibody against SOD (1:300, R&D Systems, Minneapolis, MN, USA), CAT (1:300, Abcam, Cambridge, MA, USA), peroxisome proliferator-activated receptor alpha (PPARα) (1:500, Abcam, Cambridge, MA, USA), or GAPDH (1:1000, R&D Systems MN, USA) at 4 °C overnight. Then, the membranes were incubated with horseradish peroxidase-conjugated anti-rabbit IgG (1:1000, Cell Signaling Technology Inc., USA) for 2 h. Finally, the protein bands were developed using enhanced chemiluminescence reagents (Millipore). Images were obtained using a Kodak Image Station 4000R (Eastman Kodak Co., Rochester, NY, USA) and analyzed using Kodak Image Software. The optical densities of specific immunopositive bands were normalized to the GAPDH band in the same sample.
Gapdh
Manufactured by R&D Systems
Sourced in United States, United Kingdom, Macao
GAPDH is a commonly used housekeeping gene that encodes the glyceraldehyde-3-phosphate dehydrogenase enzyme. This enzyme plays a critical role in the glycolytic pathway, catalyzing the oxidative phosphorylation of glyceraldehyde-3-phosphate to 1,3-bisphosphoglycerate.
Automatically generated - may contain errors
Lab products found in correlation
Horseradish peroxidase labeled goat anti rabbit igg, by Cell Signaling Technology (4 mentions)
Chemiluminescent reagent, by Thermo Fisher Scientific (4 mentions)
Genetools software, by Syngene (4 mentions)
G box bioimaging system, by Syngene (4 mentions)
P smad2, by Cell Signaling Technology (3 mentions)
Bca kit, by Thermo Fisher Scientific (3 mentions)
Pvdf membrane, by Merck Group (2 mentions)
Mult 1, by R&D Systems (2 mentions)
Rae 1, by R&D Systems (2 mentions)
Precellys technology, by Bertin Technologies (2 mentions)
Bis tris acrylamide gel, by Bio-Rad (2 mentions)
Snail, by Cell Signaling Technology (2 mentions)
Tgf β, by R&D Systems (2 mentions)
β actin, by Merck Group (2 mentions)
β actin, by Cell Signaling Technology (2 mentions)
Protease inhibitor cocktail, by Merck Group (2 mentions)
β actin, by R&D Systems (2 mentions)
Il 1β, by R&D Systems (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Pierce bca protein assay kit, by Thermo Fisher Scientific (2 mentions)
34 protocols using gapdh
1
Antioxidant Enzymatic Assay in Lens
2
Tumor Cell Lysis and Protein Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tumor cells infected by recombinant VVs were lysed in buffer: 50 mM Tris (pH 8.0), 5 mM EDTA, 150 mM NaCl containing 0.1% SDS, 1x complete protease inhibitor cocktail (Roche Diagnostics GmbH, Mannheim, Germany), and 1 mM PMSF. Samples (30 μg) were separated by 10% SDS-PAGE and transferred to a Trans-Blot nitrocellulose membrane (Bio-Rad Laboratories) by a wet blotting procedure (100 V, 500 mA, 90 min, 15°C) using “Mighty Small Transphor” (GE healthcare Bio-Science AB, USA). Immunodetection was performed using iBind system (Life Technologies), iBind Cards (Invitrogen, Thermo Fisher Scientific) and antibodies: ANTI-FLAG BioM2 antibody (Sigma-Aldrich, F9291), BAX (1 : 1000, Abcam), cyclin B1 (1 : 60, Sigma-Aldrich), tubulin (1 : 200, Sigma-Aldrich), GAPDH (1 : 100, R&D), and HMGB1 (1 : 6000, Abcam) and using goat anti-mouse HRP-conjugated polyclonal IgG (1 : 200, Abcam) or donkey anti-goat HRP-conjugated IgG (1 : 200, R&D) as secondary antibodies, with Novex ECL HRP chemiluminescent substrate reagent kit (Invitrogen, USA). A C-DiGit blot scanner (Li-COR Bioscience) was used for luminescent detection. Densitometric analysis of the western blot data was performed using the image analysis software Gel-Pro Analyser (Media Cybernetics) version 3.1.
3
Western Blot Protein Detection Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lysates were mixed with 4× SDS buffer and run on a NuPAGE 10% Bis–Tris Gel at 100 V. The gel was then transferred onto Immobilon P membrane for 1 h at 20 V using a semidry transfer apparatus (Bio-Rad). The membrane was blocked with 5% Blotto (Bio-Rad) in Tris-buffered saline with Tween-20 (TBST) for 1.5 h before primary (GAPDH: 1:5000 dilution [R&D Systems], lamin B1: 1:1000 dilution [Cell Signaling Technology], LAMP1: 1:1000 dilution [Thermo Fisher Scientific], voltage-dependent anion channel: 1:500 dilution [Thermo Fisher Scientific]) antibody was added at specific dilutions and incubated on a shaker overnight at 4 °C. The membrane was then washed three times with TBST at 10 min intervals. It was reprobed with (goat anti-rabbit/mice) secondary antibody for 1.5 h at room temperature. The membrane was washed four times with TBST and exposed to Enhanced Chemiluminescence Prime Western blot detection kit (GE Lifesciences) for 2 min. Blots were imaged with a Syngene digital imager.
4
Esophageal Squamous Cancer Cell Line Cultivation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Esophageal squamous cancer cell line KYSE450 was obtained from ATCC (American Type Culture Collection, Manassas, VA, USA). Cells were cultured in RPMI 1640 (21875-034, Gibco, UK) supplemented with 10% FBS (16000-044, Gibco, USA), 100 U/mL of penicillin and 100 µg/mL streptomycin (15140-122, Gibco, USA) at 37°C and 5% CO2.
The primary antibodies and drugs used in this study were as follows: PDHA1 (ab 177461, Abcam, Shanghai, People’s Republic of China); ANG2 (bs-0677R, Bioss, Beijing, People’s Republic of China); VEGFRA (GB11034B; Servicebio, Wuhan, People’s Republic of China); P53 (af0879, Affinity Biosciences, USA); Phospho p53 (S15) (ab1431, Abcam, Shanghai, People’s Republic of China); ABCG2 (12-888-42, Invitrogen, USA); CD31 (GB13063; Servicebio, Wuhan, People’s Republic of China); GAPDH (AF5718, R&D Systems, USA); ACTIN (GB12001; Servicebio, Wuhan, People’s Republic of China); Docetaxel (S1148, Selleckchem, USA); Paclitaxel (S1150, Selleckchem, USA).
The primary antibodies and drugs used in this study were as follows: PDHA1 (ab 177461, Abcam, Shanghai, People’s Republic of China); ANG2 (bs-0677R, Bioss, Beijing, People’s Republic of China); VEGFRA (GB11034B; Servicebio, Wuhan, People’s Republic of China); P53 (af0879, Affinity Biosciences, USA); Phospho p53 (S15) (ab1431, Abcam, Shanghai, People’s Republic of China); ABCG2 (12-888-42, Invitrogen, USA); CD31 (GB13063; Servicebio, Wuhan, People’s Republic of China); GAPDH (AF5718, R&D Systems, USA); ACTIN (GB12001; Servicebio, Wuhan, People’s Republic of China); Docetaxel (S1148, Selleckchem, USA); Paclitaxel (S1150, Selleckchem, USA).
5
Immunoblotting Assay for Protein Expression
6
Quantifying Immune-Related Protein Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Biopsies from ears treated either with various concentrations of DNFB or vehicle for 24 hours were homogenized individually and lysed simultaneously using Precellys technology from Bertin Technologies (Montigny-le-Bretonneux, France). Homogenized ear tissue samples were adjusted to 50 µg protein using Bradford assay, and subjected to SDS-PAGE using pre-casted 10% Bis-Tris acrylamide gel (BioRad, Copenhagen, DK). Proteins were then blotted to a PVDF membrane by wet-transfer and probed for Mult-1, Rae-1, H60 and GAPDH (R&D Systems, Abingdon, UK). Relative Mult-1 expression of treated mice was calculated based on semi-quantification of the Mult-1 bands obtained by Western blotting relative to the control samples from mice treated with vehicle and normalized to the amount of loaded protein.
7
Investigating TMEPAI/PMEPA1 in TGF-β Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Materials: TGF-β (R&D, MN), Antibodies to TMEPAI/PMEPA1 (Abnova, (mouse monoclonal) Taiwan and Proteintech, (rabbit polyclonal) CA), pSmad3 (Rockland, PA), H33258 (Bisbenzimide) and Tubulin (Sigma, MO), GAPDH (R&D, MN), pSmad2, Smad2/3 pAkt, Akt, PTEN, Snail, Slug, p27 and Actin (Cell Signaling, MA).
8
Quantitative PCR Analysis of Uterine Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from rat uteri from each group using TRIzol (Life Tech). First strand of cDNA was synthesized using total RNA and RT-PCR was carried out by TaqMan expression assays, using glyceraldehyde-3-phosphatedehydrogenase (GAPDH) as a control (R&D Systems). The sequences for TSHR, TR-α1, TR-α2, TR-β, LIFR, Gp130, JAK1 and GAPDH were performed through the ABI PRISM system. Primer sequences are shown in Table 1 and were analyzed with BLAST software on NCBI. Reactions were performed in a total volume of 20 μL and gene expression was determined by SYBR Premix Ex Taq TM II (TaKaRa Biotechnology Co., Ltd.) in accordance with the manufacturer’s instructions. Reactions began with a 10 s hot activation of Taq polymerase at 95°C, followed by 40–45 cycles of amplification in three steps (denaturation at 95°C for 5 s, 30 s annealing at 60°C and 30 s extension at 72°C). The mRNA expression was measured as a ratio to GAPDH.
Primer sequences for the real-time PCR.
| Gene | Forward primer | Reverse primer |
|---|---|---|
| Tshr | CCCTGTCCCTCACTATCTGC | ACTGGTTCTCCTGCCTTCAG |
| Tr-α1 | CCACATGAAAGTCGAGTGCC | AAGAGATGGGGGTTCTCCCT |
| Tr-α2 | GGGGAAGGAGAAGGAGCAT | AGGGGTAGGAGGGTGGTCTT |
| Tr-β | GGTGGCAAGGTTGATCTGGA | CACAGGGCAGCTCACAAAAC |
| Lifr | CCCACGCAACACAGAATACA | GGTCAGGAGCCATTTTCAAG |
| Gp130 | ACCACCACCACCACTTGACT | GTGCTTCCTCCACCAACATC |
| Jak1 | GGAGGAGCAGAATCCAGACA | TCAACCTTCCCAAAGTGACC |
| GAPDH | GACATGCCGCCTGGAGAAAC | AGCCCAGGATGCCCTTTAGT |
9
Antibody Characterization and Cell Signaling Assays
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Antibodies were obtained from sources indicated. TMEPAI (Abnova, CA), pSmad3, V5 epitope tag (Rockland, PA), Smad2/3 (BD Biosciences, CA), Smad 4 (SantaCruz biosciences, CA), Flag and Tubulin (Sigma, MO), GAPDH (R&D, MN), Actin and p27 (Epitomics, CA), pSmad2, Akt, pAkt, p21, phosphoGSK-3β, Snail, PTEN and Nedd4 (Cell Signaling, MA), Smad 7 (Imgenex, CA). Other reagents were obtained as indicated below. ProLong® Gold Antifade Reagent with DAPI, Fluorescein phalloidin (Lifetechnologies, NY), TGF-β (R&D, MN), LY294002 (Calbiochem, CA), H33258 (Bisbenzimide), actinomycin D, SB431542 and cycloheximide (Sigma, MO); doxycline (Clonetech, CA).
10
ACE2 Expression Quantification in Primary Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell lysates (100 000 cell equivalents per well) were probed with antibodies to GAPDH (R&D Systems), β-actin (Sigma-Aldrich), and ACE2 (Novus Biologicals). The appropriate secondary horseradish peroxidase antibodies were used for imaging with an iBright 1500 system (Invitrogen), and ImageJ (Version 1.49 23) software was used for quantification. Cell surface expression was measured by means of flow cytometry using ACE2–phycoerythrin (PE) (Novus Biologicals), as recommended by the manufacturer. Primary cell populations were incubated with CD19-PacificBlue (BioLegend), CD3–fluorescein isothiocyanate (FITC), CD4-FITC, CD8-FITC, CD14– allophycocyanin (APC), and CD56-AlexaFluor700 (all BD Biosciences). Primary cells were treated with human immunoglobulin G (10 µg/1 million cells) to block Fc receptors on B cells. Data were acquired on an LSR II flow cytometer using a single-stained AbC bead kit (ThermoFisher) for compensation [17 (link)]. Viable cells were gated based on forward and side scatter, doublets were excluded, and “fluorescence minus 1” controls were assessed. PE quantitation beads (BD Quantibrite) were analyzed, according to the manufacturer’s instructions, to quantify ACE2 molecules per cell. At least 10 000 total events were collected in each experiment and the FlowJo program (Tree Star) was used for data analysis.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!