Pureyield plasmid maxiprep system

We used synthetic samples containing EBOV and ZIKV nucleic acids in our validation experiments. We prepared the EBOV samples by cloning a genetic sequence (Table 1) encoding the production of the EBOV GP capsid protein in an Escherichia coli strain (TOP10). Similarly, we cloned a genetic sequence encoding the production of the ZIKV E capsid protein in an E. coli strain (TOP10) to produce ZIKV nucleic acid material (Table 1). The EBOV sequence was designed based on the consensus of GP sequences of the Zaire ebolavirus documented in GenBank from 1976–2014 (S1 Fig). The ZIKV sequence was designed by considering the consensus of the E gene sequences of the ZIKV strains documented globally in GenBank from 2013–2016 (S2 Fig).
The engineered bacterial strains were cultured overnight in LB-media (250ml) at 37°C in Erlenmeyer flasks under orbital agitation at 200 RPM. After 12 hours of culture, the bacteria were harvested by centrifugation and then lysed using a continuous homogenizer. Synthetic viral DNA was purified from the bacterial samples using the PureYield Plasmid Maxiprep System (Promega, WI, USA). Samples containing different concentrations of synthetic nucleic acids of EBOV and ZIKV were prepared by successive dilutions from stocks containing 400 ng/L of viral nucleic acids.

The cDNA of hsEH FL was kindly provided by Dr C Morisseau (UC Davis) and was cloned into the pcDNA3.1D/V5-His-TOPO^® vector (Invitrogen) using the pcDNA3.1 Directional TOPO^® Expression Kit (Invitrogen). The hsEH FL cDNA was PCR-amplified using primers designed to facilitate directional cloning (Table 1), as detailed in the kit instructions, generating a blunt-end PCR product that was mixed using a molar ratio of 1:1 of insert:TOPO^® vector. The mixture was then used to chemically transform One shot^® TOP10 E. Coli competent cells. Successful cloning was confirmed by sequencing (MWG Eurofins). The mammalian expression vector cloned with the hsEH FL cDNA was finally amplified in E. coli DH5α C2987 competent cells (NEB) and purified using the Pure Yield™ Plasmid Maxiprep system (Promega), out of a 0.5 L bacterial culture.Table 1

Primers used in the cloning of the hsEH FL into pcDNA™3.1D/V5-His-TOPO^® vector. The primers were synthesised by Sigma.

Table 1

Primer	Sequence
Forward	5′ CACCATGACGCTGCGCGCGGCC 3′
	Bold: pcDNA™3.1D/V5-His TOPO® annealing sequence to enable directional cloning
	Underlined: ATG initiation codon
	Normal: hsEH FL cDNA annealing sequence
Reverse	5′ CATCTTTGAGACCACCGGTGG 3′

Total RNA from U2OS cells was extracted and reverse-transcribed into cDNA as previous described using an specific primer for CtIP mRNA (S4 Table). The 5′-UTR regions corresponding to the G4less and G4 isoforms were amplified by PCR by adding specific target sites for restriction enzymes (Takara). Amplified regions were cloned into the pEGFP-N1 vector (Clontech). Plasmid DNA was inserted into competent cells of the DH5α strain of Escherichia coli. Vector DNA was purified using PureYield Plasmid Maxiprep System (Promega) and sequenced to check the proper integration of the insert into the GFP plasmid.

Human DNMT isoforms 3B1, Δ3B2, 3B3, Δ3B4 and 3L, containing a MYC-tagged DNA sequence ligated to the 5′- ends, were amplified from pIRESpuro/Myc constructs48 (link) (a modified version of the pIRESpuro3 vector, Clontech), a gift from Dr Allen Yang (USC). Catalytically inactive mutants containing a cysteine to serine alteration in position 651 of DNMT3B1 and 452 of DNMTΔ3B2 proteins were established as previously described35 (link). MYC-tagged DNMT sequences were cloned into pLJM1 lentivirus vector at EcoRI and AgeI sites using Infusion HD PCR Cloning Plus (Clontech) following the manufacturer's protocol. To produce lentivirus for the specific constructs, the vesicular stomatitis virus envelope protein G-expression construct pMD.G1, the packaging vector pCMV ΔR8.91 and transfer vector pLJM1 were used as previously described49 (link). All vectors were amplified and purified using the PureYield Plasmid Maxiprep system (Promega), according to the manufacturer's instructions. The HCT116 derivative cell lines 3BKO, 3ABDKO and DKO8 were stably transfected with a lentivirus and selected with 2 μg ml⁻¹ puromycin for 14, 14 and 21 days, respectively.

We purchased the vector pCMV6-AC (OriGene Technologies, Inc. Rockville, MD, USA) containing wild-type (WT) TNFRSF1A cDNA ready for transfection. Three new constructs containing three mutant TNFRSF1A - cDNA (c.262 T > C (S59P); c.362G > A (R92Q) and c.236C > T (T50M)) were obtained using site-direct mutagenesis, and the following mutagenic primers were used: TNFRFS59P: 5′AGTGTGAGAGCGGCCCCTTCACCGCTTCAG3′; TNFRFR92Q: 5′ CTTCTTGCACAGTGGACCAGGACACCGTGTGTGGCTG 3′; TNFRRT50M: 5′ CTCACACTCCCTGCAGTCCATATCCTGCCCCGGGCCTGG 3′.
All the products were sequenced along the full length of the TNFRSF1A coding region to ensure that only the desired mutations were introduced. Plasmid isolation from bacterial culture was carried out using the PureYield Plasmid Maxiprep System (Promega, Milano, Italy).

Plasmids were propagated in NEB 5-alpha competent E. coli cells (New Englad Biolabs) and purified with QIAprep spin miniprep kits (Qiagen) or the PureYield plasmid maxiprep system (Promega) before transfection.
Constructs for human myosin Va (amino acids 1–1091), myosin VI (amino acids 1–1021), calmodulin, and FHL3-Halo were reported previously^{1 (link)}. Human Zyxin-Halo constructs were subcloned into a pCAG mammalian expression vector with a C-terminal 3C protease cleavage site and eGFP tag for affinity purification. Human VASP-Halo constructs were subcloned into a pET15b bacterial expression vector containing an N-terminal Strep-Tag II and 3C cleavage site, as well as a C-terminal 3C site and 6xHis-Tag. Human ɑ-actinin-Halo constructs were subcloned into a pET15b bacterial expression vector containing an N-terminal 6xHis-Tag and Tobacco Etch Virus (TEV) cleavage site. Human profilin in a pMW plasmid was a generous gift from Henry Higgs, Dartmouth University. Human Zyxin-mNeonGreen and F-tractin-mScarlet were subcloned into a pM98 mammalian expression vector. The template for mScarlet was a gift from Dorus Gadella (University of Amsterdam) via Addgene (plasmid #85054). All plasmids were assembled with Gibson cloning, and point mutations were generated by site-directed mutagenesis.