Sf cell line 4d nucleofectortm x kit s

Cas9 protein and sgRNA or scramble sgRNA were mixed in 1:2.5 molar ratio (Synthego Corporation) and incubated at 37 °C for 10–15 min. 1e6 of either primary CD3+ T cells or MM cell lines were spun down and washed with PBS, resuspended in 20 μL of P3 nucleofection/solution plus cas9/sgRNA mixture (P3 Primary Cell 4D-NucleofectorTM X Kit S) for primary T cells or SF Cell Line 4D-NucleofectorTM X Kit S (Lonza) for MM cell lines, and nucleofected using EO-115 or DS-137 nucleofection program in Lonza 4D-Nucleofector, respectively. 80 μL of warm (CTS^™ OpTmizer^™ T Cell Expansion SFM, Gibco^™) or RPMI 1640 media (Gibco) was plated into each well and incubated at 37 °C for 15 min, then transferred to a 12-well plate supplemented with IL-7 and IL-15 for T-CD3+ T cells and 6-well plate for cell lines to recover. Then, based on the surface expression by flow cytometry, negative clones were sorted using FACSARIA-Fusion or FACSARIA III flow cytometer (BD Biosciences). sgRNA sequences were obtained from Brunello Library(56 (link)) as follows: CD70: CAGCTACGTATCCATCGTGA, AGCGCUGGATGCACACCACG; TFAP2A: AUCCUCGCAGGGACUACAGG; CD27: AGUGUGAUCCUUGCAUACCG. sgRNA sequence for TNFRSF17 (BCMA) was obtained through from Synthego Corporation tool: GGUGUGACCAAUUCAGUGAA. Negative Control, scrambled sgRNA#1 and #2 mod-sgRNA specified by Synthego Corporation.