Total RNA was extracted from retinal tissues with TRIzol reagent (Invitrogen, Gaithersburg, MD, USA) and cDNA was synthesized using μMACS™ DNA Synthesis kit (Miltenyi Biotech GmbH, Bergisch-Gladbach, Germany). All quantitative polymerase chain reaction (PCR) reactions were performed via a real-time CFX96 Touch PCR detection system (Bio-RadLaboratories, Reinach, Switzerland). The primers used in quantitative reverse transcription-PCR were: Bax: 5′-AGCTCTGAACAGATCATGAAGACA-3′ (forward) and 5′-CTCCATGTTGTTGTCCAGTTCATC3′ (reverse); Bcl-2: 5′-GGACAACATCGCTCTGTGGATGA-3′ (forward) and 5′-CAGAGACAGCCAGGAGAAATCAA3′-(reverse); Caspase-3: 5′-TGTCGATGCAGCTAACC-3′ (forward) and 5′-GGCCTCCACTGGTATCTTCTG-3′ (reverse); Calpain-2: 5′-CCCCAGTTCATTATTGGAGG-3′ (forward) and 5′-GCCAGGATTT CCTCATTCAA-3′ (reverse). The relative expression levels were normalized and quantified to obtain the ΔΔCT values (DATA assist Software v2.2, Applied Biosystems).
Cfx96 touch pcr detection system
Manufactured by Bio-Rad
Sourced in United States, Switzerland
The CFX96 Touch PCR detection system is a real-time PCR instrument designed for quantitative gene expression analysis, genotyping, and other molecular biology applications. It features a 96-well format, a high-resolution touch screen interface, and compatibility with a wide range of fluorescent dyes and probes.
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Thermo Fisher Scientific (4 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (4 mentions)
Primescript rt reagent kit, by Takara Bio (3 mentions)
Powerup sybr green master mix, by Thermo Fisher Scientific (3 mentions)
μmacs dna synthesis kit, by Miltenyi Biotec (2 mentions)
Data assist software v2, by Thermo Fisher Scientific (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Cfx real time analysis software, by Bio-Rad (2 mentions)
Plant total rna extraction kit, by Tiangen Biotech (1 mentions)
Dnase 1, by Tiangen Biotech (1 mentions)
Ssoadvanced preamp supermix, by Bio-Rad (1 mentions)
Sybr reagent, by Vazyme (1 mentions)
Nanodrop one microvolume uv vis spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Accurate Biology (1 mentions)
T100 thermal cycler, by Bio-Rad (1 mentions)
Sybr green super mix udg, by Thermo Fisher Scientific (1 mentions)
Precellys 24 homogeniser, by Bertin Technologies (1 mentions)
Iscript cdna synthesis kit, by Bio-Rad (1 mentions)
Rt master mix, by Thermo Fisher Scientific (1 mentions)
Cytoflex, by Beckman Coulter (1 mentions)
17 protocols using cfx96 touch pcr detection system
1
Quantitative Analysis of Retinal Gene Expression
2
Quantification of Retinal Apoptosis Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from pooled retinal patches with a commercial reagent (Trizol, Gibco Inc., Grand Island, NY), followed by cDNA synthesis using the μMACS DNA Synthesis kit (Miltenyi Biotech GmbH, Bergisch-Gladbach, Germany). Ten retinal patches from each animal group were prepared for qRT-PCR examination. Totally 40 retinal patches were involved in qRT-PCR examination. GAPDH was used as the internal standard of mRNA expression. Reactions were performed in a real-time CFX96 Touch PCR detection system (Bio-Rad Laboratories, Reinach, Switzerland). The amplification program consisted of polymerase activation at 95 °C for 5 min and 50 cycles of denaturation at 95 °C for 1 min, annealing and extension at 59 °C for 30 s. The primers used in qRT-PCR were: Bax: 5′-AGCTCTGAACAGATCATGAAGACA-3′ (forward) and 5′-CTCCATGTTGTTGTCCAGTTCATC-3′ (reverse); Bcl-2:5′-GGACAACATCGCTCTGTGGATGA-3′ (forward) and 5′-CAGAGACAGCCAGGAGAAATCAA-3′ (reverse); Caspase-3: 5′-TGTCGATGCAGCTAACC-3′ (forward) and 5′-GGCCTCCACTGGTATCTTCTG3′- (reverse); Calpian-2: 5′-CCCCAGTTCATTATTGGAGG3′ (forward) and 5′-GCCAGGATTTCCTCATTCAA-3′ (reverse); Foxo-3: 5′-CGGGATCCATGGCAGAGGCACCGGCTTC-3′ (forward) and 5′-GCTCTAGATCAGCCTGGCACCCAGCTCTG-3′ (reverse). The relative expression levels were normalized and quantified to obtain the ΔΔCT values (DATA assist Software version 2.2; Applied Biosystems, Foster City, CA).
3
Quantifying VEGF and miR-204-5p Expression in Retinal Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from retinal tissues and rRECs using TRIzol reagent (cat. no. CW0580S; Beijing CWBio, Beijing, China) according to the manufacturer's protocol. RNA quality was evaluated by agarose electrophoresis and the quantity was determined via spectrophotometry at 260 and 280 nm. A total of 500 ng RNA was reverse transcribed into cDNA using the miRScript system (GenScript Co., Ltd., Nanjing, China) according to the manufacturer's protocols. qPCR was performed using SYBR Green qPCR Super mix (cat. no. CW0957M; Beijing CWBio) on a CFX96 Touch PCR Detection system (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The thermocycling conditions were as follows: 95°C for 5 min followed by 40 cycles of 95°C for 30 sec, 60°C for 30 sec. All experiments were performed with triplicate. The relative expression of VEGF was normalized to β-actin using the 2−ΔΔCq method (22 (link)). U6 was used as an endogenous control to analyze the expression of miR-204-5p. The primers for RT-qPCR were as follows: VEGF, forward, 5′-GAGTTAAACGAACGTACTTGCAGA-3′ and reverse, 5′-TCTAGTTCCCGAAACCCTGA-3′; β-actin, forward, 5′-TGGCTGGGGTGTTGAAGGTC-3′ and reverse, 5′-ATGGTGGGTATGGGTCAGAAGG-3′; miR-204-5p, forward, 5′-ACACTCCAGCTGGGTTCCCTTTGTCATCCTAT-3′ and reverse, 5′-CTCAACTGGTGTCGTGGA-3′; and U6, forward, 5′-CTCGCTTCGGCAGCACA-3′ and reverse, 5′-AACGCTTCACGAATTTGCGT-3′.
4
Quantifying Viral RNA via RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Details on sample preparation for nucleic acids extraction based on conventional protocol were described in Supplementary Material. To quantify the amount of viral RNA extracted, real-time reverse-transcription PCR using VetMAX™-Plus One-Step RT-PCR Kit (Thermofisher, Massachusetts, USA) and Bio-Rad CFX96 Touch™ PCR detection system (California, USA) was applied. For Conventional RT-PCR, a 30 μL of reaction solution was set up containing 15 μL of eluted supernatant, 7.5 μL of 4 × reaction buffer, 1.5 μL enzyme mixture, and optimized concentrations of primers (1 μmol/L each) and probe (1 μmol/L) (Table S1 , supporting information). Subsequent thermal cycling was performed at 55 °C for 15 min, followed by 95 °C, 30 s and then 45 cycles of 95 °C, 10 s, and 60 °C, 35 s. Fluorescence was taken after each cycle, and the threshold cycle (Ct) value was calculated by the Bio-Red analysis system.
5
Zika and Chikungunya Virus Passaging
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SCV-ZIKA/CHIK was passaged ten times in subconfluent SCS cells, with 3 days of culture for each passage. After each culture period, cells were collected by scraping and were homogenized (as described2 (link)) and reseeded at MOI = 0.01–0.001. The MOI was estimated by plaque formation in SCS cells. PCR of infected cells after passage 1 and passage 10 was performed for the A39R and B7R-B8R loci on cell lysates as described above. For quantitative PCR, DNA was extracted from lysates using the Magery Nagel Nucleospin tissue extraction kit (Scientifix, Vic, Australia). ZIKV M primers were F 3′ TTGGTCATGATACTGCTGATTGC 5′, R 3′ CCTTCCACAAAGTCCCTATTGC 5′ and VACV G1L primers were F 3′ TCGGTGTCTATAACGGAAC 5′, R 3′ GTTTAGTCGTGTCTACAAAAGG 5′. Quantitative PCR was undertaken (in duplicates) using the CFX 96 touch PCR detection system (Biorad) using the same cycling parameters for both sets of primers; 1 × 50 °C 2 min, 1 × 95 °C 2 min, 45 × 94 °C 5 s, 52 °C 10 s and 72 °C 40 s), with analysis using Biorad CFX Real Time Analysis software.
6
Detecting SPFMV and SPCSV Co-infection in Sweet Potato
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two to three leaves were taken from each variety and the total RNA was extracted using the plant total RNA extraction kit (Tiangen Biochemical Technology Co., Ltd., Beijing, China), and the genomic DNA in the total RNA was removed by DNase I (Tiangen Biochemical Technology Co., Ltd., Beijing, China). A total of 1 μg of RNA was used as template. The first strand of cDNA was synthesized using the Prime Script RT reagent Kit (Ta Ka Ra, Dalian, China).
The con-infection of SPFMV and SPCSV was detected by RT-qPCR method, using the primers developed by Lu et al. (Table 4 ) [27 ]. RT-qPCR was performed using SsoAdvanced PreAmp Supermix (Bio-Rad Laboratories, Hercules, CA, USA) in a Bio-Rad CFX96 Touch PCR Detection System with the following conditions: 95 °C for 10 min and then 45 cycles of 95 °C for 15 s and 58–66 °C for 30 s, followed by a melt cycle of 65 °C for 5 s and 95 °C for 15 s [39 (link),40 (link)]. Reactions were performed in triplicate, with a negative nuclease-free water control in each run. Sweet potato H2 B and UBI encoding genes were used as a double internal control for normalization of the gene expression data [41 (link)]. The relative expression levels of virus were quantified with the delta threshold cycle (ΔCt) method [42 (link)], referenced to the internal control. The experiments were repeated three times in independent RT-qPCR reactions.
The con-infection of SPFMV and SPCSV was detected by RT-qPCR method, using the primers developed by Lu et al. (
7
Quantitative Analysis of RNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted by Trizol reagent (#AG21102, Accurate Biology, Hunan, China). One thousand nanograms of mRNA was used to synthesize complementary DNA (cDNA) for each sample using Prime-ScriptTM II Reverse Transcriptase (#R323-01, Vazyme, Nanjing, China) and polymerase chain reaction (PCR) Amplifier (#T100 Thermal Cycler, Bio-Rad). Complementary DNA concentration was determined using Microvolume UV-Vis Spectrophotometer (NanoDrop One, Thermo Fisher, Waltham, USA). Primer sequences for real-time quantitative polymerase chain reaction (RT-qPCR) are shown in Table 1 , and GAPDH was used as the endogenous control for mRNA. Polymerase chain reactions were performed in a total volume of 10 µL, which included 5 µL synergy brands (SYBR) reagent (#Q711-02, Vazyme, Nanjing, China) and 0.5 µL cDNA together with primers at the concentration of 0.25 mM. For the detection of gene expression, CFX96 Touch PCR Detection System (Bio-Rad) was used for PCR. All results were computed by the 2−ΔΔCt method for the relative quantification of target mRNAs in GC cells and normal controls. Each detection was established in 4 duplicates and conducted for 3 times repeatedly.
8
Quantifying Gene Expression in PSCs with SCS and PDGF-BB
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To investigate gene expression in PSCs stimulated by SCS with PDGF-BB, qRT-PCR was performed. PSCs were seeded in 6-well plates and treated with 2 nM 26SCS, 1 nM PDGF-BB, and 2 nM 26SCS plus 1 nM PDGF-BB respectively. The group without 26SCS or PDGF-BB treatment was set as a negative control. After 12 h, total RNAs were extracted with TRIzol reagent, followed by a reverse transcription step with PrimeScript RT reagent kit according to the manufacturer's instructions. The qRT-PCR was performed on a CFX96 Touch PCR detection system (Bio-Rad, USA) with a hot start denaturation step at 95 °C for 30 s, and then fluorescence intensity was recorded during 40 cycles at 95 °C for 5 s and 60 °C for 30 s. GAPDH was used as a housekeeping gene to normalize the expression of the gene of interest depending on the experiment. The sequences of primers are listed in Table S1 .
9
Quantifying Yellow Fever Virus RNA in Liver Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Liver lobes were cut in half lengthways stored in RNAlater solution, kept overnight at 4 °C and then stored at −80 °C. RNA was extracted by thawing the liver pieces in TRIzol (Life Technologies, Carlsbad, CA, USA) while homogenized using four ceramic beads at 6000 rpm twice for 15 s (Precellys 24 Homogeniser, Bertin Instruments, Montigny-le-Bretonneux, France). cDNA was generated using iScript cDNA Synthesis kit (Bio-Rad, Irvine, CA, USA) according to the manufacturer’s instructions. qPCR was performed using the following primers: YFV 17D Forward 5ʹ GTATTCTGTGGATGCTGACC 3ʹ, YFV 17D Reverse 5ʹ TATCCCGGTTTCAGGTTGTG 3ʹ, which span the YFV NS5-3’UTR junction [35 (link)], with normalization using RPL13A cDNA levels as described [36 (link)]. qPCR was performed in a reaction consisting of 2 µL of cDNA, 5 µL of SYBR green Super mix-UDG (Invitrogen, Carlsbad, CA, United States), 2 µL water, and 1 µL of 10 mM of forward and reverse primers. The qPCR reaction was undertaken using CFX 96 touch PCR detection system (Bio-Rad) under the following cycling conditions: 1 × 95 °C 3 min, 40 × 95 °C 5 s and 60 °C 30 s. Data were analysed using Bio-Rad CFX Real Time Analysis software (Bio-Rad, Irvine, CA, USA). Data is presented as a ratio of YFV 17D RNA levels over RPL13A mRNA levels, with levels quantitated using a standard curve of serially diluted positive sample.
10
Characterization of M1-polarized BV2 Microglia
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The polarization of the M1-phenotype in BV2 microglia was verified by the detection of the M1-phenotype biomarkers CD40 and INOS using flow cytometry analysis. The cells were incubated with CD40 (BioLegend, San Diego, CA, USA) and INOS (BioLegend, San Diego, CA, USA) at room temperature in darkness for 20 min and assessed using a flow cytometer (CytoFlex; Beckman Coulter, Inc., Brea, CA, USA) according to the manufacturer’s protocol. A panel of proinflammatory markers (IL-1β, IL-6 and TNF-α) was also detected to confirm the polarization of M1-BV2 microglia using quantitative reverse-transcription polymerase chain reaction (qRT-PCR). Briefly, total RNA was extracted from BV2 microglia using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) and reverse-transcribed to cDNA using RT Master Mix (Invitrogen, Carlsbad, CA, USA). QRT-PCR was performed using Ultra SYBR Mixture in a CFX-96 Touch PCR Detection system (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The expression levels of IL-1β, IL-6, and TNF-α were normalized to that of the reference GAPDH and calculated using the 2−ΔΔ Ct method. The primers used for qRT-PCR are reported in Table 1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!