A chromatin immunoprecipitation (ChIP) assay was carried out using the ChiP-IT Express Enzymatic Magnetic Chromatin Immunoprecipitation Kit or the Re-ChIP-IT kit (Active Motif, Carlsbad, CA) according to the manufacturer’s protocol. Approximately 300 mg of liver tissue was minced, homogenized, and fixed with 1% formaldehyde for the in vivo ChIP assay. The following ChIP primer sets were used for the ChIP assay: human AHR ChIP primer set I (−283 to 90, forward): 5′-TTA GCT GAC CCA CCG TCT CT-3′, (−283 to −90, reverse): 5′-TCC ATT CCG TCT TCC TTG AG-3′; human AHR ChIP primer set II (−1969 to −1779, forward): 5′-TTA GCT GAC CCA CCG TCT CT-3′, (−1969 to −1779, reverse): 5′-TTG GCT ATT TGG TGC AGT CA-3′; Mouse AHR ChIP primer set (−138 to +141, forward): 5′-AGA ACC TCG GAC TGC AAG AA-3′, (−138∼ +141, reverse): 5′-AGT CCG TCC ACC AGT TCG T-3′. For ChIP assays, NR2E3 antibody from Santa Cruz Biotech (Cat#: sc-292264) or Aviva Systems Biology (Cat#: ARP39069) was employed. All the ChIP-PCR reactions were performed using a 7300HT Real-Time PCR System with a 96-well block module (Applied Biosystems). The cycling conditions were 56 °C for 30 min and 95 °C for 10 min, followed by 50 cycles of 95 °C for 25 s and 60 °C for 60 s.
Re chip it kit
Manufactured by Active Motif
The Re-ChIP-IT kit is a tool designed for performing re-chromatin immunoprecipitation (re-ChIP) experiments. The kit provides the necessary reagents and protocols to enable sequential chromatin immunoprecipitation, allowing researchers to investigate the co-occupancy of multiple proteins or histone modifications on the same DNA fragment.
Automatically generated - may contain errors
Lab products found in correlation
Chip it high sensitivity kit, by Active Motif (3 mentions)
Bioruptor pico, by Diagenode (2 mentions)
Ideal chip qpcr kit, by Diagenode (2 mentions)
Chip it express enzymatic kit, by Active Motif (2 mentions)
Abi prism 7900ht, by Thermo Fisher Scientific (2 mentions)
Oligoperfect designer, by Thermo Fisher Scientific (2 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (2 mentions)
Quantstudio 6 qpcr machine, by Thermo Fisher Scientific (2 mentions)
Zymo chip dna clean and concentrator kit, by Zymo Research (2 mentions)
E220 sonicator, by Covaris (2 mentions)
Chip it express enzymatic magnetic chromatin immunoprecipitation kit, by Active Motif (1 mentions)
7300ht real time pcr system, by Thermo Fisher Scientific (1 mentions)
96 well block module, by Thermo Fisher Scientific (1 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions)
Dynamo flash sybr green qpcr kit, by Thermo Fisher Scientific (1 mentions)
Anti pol 2 ser5p, by Abcam (1 mentions)
Anti h3k27me3, by Merck Group (1 mentions)
Anti h3k27me3, by Abcam (1 mentions)
Chromatin immunoprecipitation chip assay kit, by Merck Group (1 mentions)
Simplechip enzymatic chromatin ip kit, by Cell Signaling Technology (1 mentions)
19 protocols using re chip it kit
1
Chromatin Immunoprecipitation (ChIP) Assay
2
Chromatin Immunoprecipitation of DNA Damage Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNAPII, NBS1, MRE11, and MDC1 ChIP were performed using the iDeal ChIP-qPCR Kit (Diagenode, catalog no. C01010180) following the manufacturer’s instructions. HeLa cells were sonicated using the Bioruptor Pico (Diagenode, catalog no. B01060001) for 8 cycles of 30-s ON and 30-s OFF at high-power setting. For RNAPII, MRE11, and MDC1 ChIP, 3 μg of antibody was used, while 1.5 μg of antibody was used for NBS1 ChIP. γH2AX ChIP was performed using the ChIP-IT Express Enzymatic Kit (Active Motif, catalog no. 53009), following the manufacturer’s instructions. Chromatin was digested for 7 min, and 50 μg of chromatin and 3 μg of antibody were used for each γH2AX ChIP.
Re-ChIP was performed using the Re-ChIP-IT Kit (Active Motif, catalog no. 53016) according to the manufacturer’s instruction. Chromatin for the Re-ChIP was prepared using the ChIP-IT High Sensitivity Kit (Active Motif, catalog no. 53040), as described above. For each Re-ChIP, 50 μg of chromatin and 3 μg of antibody were used. Antibody used and sequences of primers used for real-time qPCR analysis are shown in table S4.
Re-ChIP was performed using the Re-ChIP-IT Kit (Active Motif, catalog no. 53016) according to the manufacturer’s instruction. Chromatin for the Re-ChIP was prepared using the ChIP-IT High Sensitivity Kit (Active Motif, catalog no. 53040), as described above. For each Re-ChIP, 50 μg of chromatin and 3 μg of antibody were used. Antibody used and sequences of primers used for real-time qPCR analysis are shown in table S4.
3
Sequential ChIP-qPCR Analysis of Neuronal Epigenome
4
ChIP-Based Quantification of Transcriptional Regulation
5
Analyzing HepG2 Chromatin Interactions
6
Twist1-Smad4 Complex Regulates CXCL12 Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP-qPCR assays were used to determine the association of endogenous Twist1 and Smad4 proteins with an E-box and two SBEs on CXCL12 promoter, respectively, in control and MAOB-OE PrSC cells treated with TGFβ1 (10 ng/ml) for 12 hours using a SimpleChIP Enzymatic Chromatin IP Kit (Cell Signaling Technology, 9002) following the manufacturer’s instructions. Briefly, the chromatin was cross-linked with nuclear proteins, enzymatically digested with micrococcal nuclease followed by sonication, and immunoprecipitated with anti-Twist1, anti-Smad4 (Cell Signaling Technology, 46535, RRID:AB_2736998), or a normal immunoglobulin G (IgG, Cell Signaling Technology, 2729, RRID:AB_1031062). For further determining the association of a Twist1-Smad4 protein complex with the E-box/SBE-encompassing CXCL12 promoter region, a re-ChIP–qPCR assay was performed using a Re-ChIP-IT Kit (Active Motif, 53016) following the manufacturer’s instructions. Briefly, the chromatin eluted from the first ChIP assayed with anti-Smad4 antibody as described above was subjected to the second ChIP (re-ChIP) with anti-Twist1 or a normal IgG. The immunoprecipitates were pelleted with agarose beads, purified, and subjected to qPCR with primers specifically targeting the E-box/SBE-centric CXCL12 promoter region. Primer sequences were forward 5′-GCTTTGTTTGTACAGGCGAGG-3′ and reverse 5′-CTGCTTTCTGTGCGTGGG-3′.
7
ChIP Assay with ERα Antibody
8
ChIP-re-ChIP of MYCN and WDR5 in RPL38 Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP-re-ChIP was performed by combining the ChIP-IT High Sensitivity kit (Active Motif, cat. 53040) and Re-ChIP-IT kit (Active Motif, cat. 53016). IMR32 cells were fixed and sheared to achieve chromatin fragmented to a range of 200 to 700 bp by following the manual of the ChIP-IT High Sensitivity kit. Next, ChIP-re-ChIP was performed by following the manual of the Re-ChIP-IT kit. The first ChIP was performed by using either anti-MYCN antibody or IgG control. The eluted chromatin acquired from the first MYCN ChIP reaction was used for the second ChIP by using anti-WDR5 antibody or IgG. ChIP-PCR was performed by using primers that recognize MYCN/WDR binding site within the RPL38 gene promoter region (GRCh38.p14, Chr18:74203681–74203844). The sequences of the primer sets are: RPL38_F, TTTCGTCCTTTTCCCCGGTT; RPL38_F, AAATATCGGCCCCATCGCAC.
9
ChIP-qPCR and ReChIP Sequencing
10
ChIP-qPCR and ReChIP Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP-qPCR on immunoprecipitated chromatin was performed using the SYBR Green PCR Master Mix and an ABI Prism® 7900HT instrument (Applied Biosystems®). Primers were designed using OligoPerfect Designer™ (Invitrogen) and reactions were performed in triplicate. Chromosome coordinates of the validated peaks and the corresponding primers are listed in Supplementary Table 1. The relative amount of each amplified fragment was normalized with respect to the amplification obtained from input DNA using the ΔΔCt method and represented as indicated in the corresponding figure legends.
ReChIP experiment was performed with the Re-ChIP-IT kit (#53016, Active Motif) according to the manufacturer's protocol. Briefly, MCF10A cells were fixed, lysed and sonicated as described in the ChIP protocol. Fifty μg of chromatin were incubated with 20 μg of the first antibody (SA1, SA2 or IgG) in presence of magnetic beads, washed, eluted and further incubated with 5 μg of the second antibody (SA1, SA2, SMC1 or IgG). Eluted chromatin was analyzed by quantitative PCR. 1 ng of immunoprecipitated chromatin from two conditions, SA2 ChIP followed by IgG ReChIP and SA2 ChIP followed by SA1 ReChIP, was used to prepare libraries for Re-ChIP sequencing. Libraries were prepared with 18 PCR cycles. Peaks were called in SA2-SA1 ReChIP upon normalization with SA2-IgG ReChIP signals.
ReChIP experiment was performed with the Re-ChIP-IT kit (#53016, Active Motif) according to the manufacturer's protocol. Briefly, MCF10A cells were fixed, lysed and sonicated as described in the ChIP protocol. Fifty μg of chromatin were incubated with 20 μg of the first antibody (SA1, SA2 or IgG) in presence of magnetic beads, washed, eluted and further incubated with 5 μg of the second antibody (SA1, SA2, SMC1 or IgG). Eluted chromatin was analyzed by quantitative PCR. 1 ng of immunoprecipitated chromatin from two conditions, SA2 ChIP followed by IgG ReChIP and SA2 ChIP followed by SA1 ReChIP, was used to prepare libraries for Re-ChIP sequencing. Libraries were prepared with 18 PCR cycles. Peaks were called in SA2-SA1 ReChIP upon normalization with SA2-IgG ReChIP signals.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!