Takara kit

Tissue samples including liver, suet, and backfat from four 30-day-old piglets for each genotype (SINE+/+, SINE+/−, and SINE−/−) were prepared. The mRNA was extracted using Trizol (Invitrogen, Shanghai, China), and 1000 ng RNA was reverse-transcribed into cDNAs using a TAKARA Kit (Takara, Tokyo, Japan). Then, quantitative real-time PCR (qPCR) was performed using the 7900HT Fast Real-Time PCR System (Applied Biosystems, New York, NY, USA) in a total volume of 20 μL containing SYBR mix (10 μL) (Takara, Tokyo, Japan), primers (4 ng), and cDNA sample (50 ng). Gene expression was normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and measured using the 2− ΔΔCt method. The primer sequences also are shown in Table S1.

Total RNA was extracted with TRIzol (Life Technologies, U.S.) from CSC-hGC, pMCSC-tGC^[G1], and pMCSC-tGC^[G2]. A TAKARA kit (TaKaRa Biotechnology Co., Ltd., Dalian, China) was used for quantitative real-time PCR. The 10 μl reaction volume contained 5 μl of SYBR premix Ex Taq™, 0.8 μl of DNA template, 0.4 μl of each primer, and 3.4 μl of dH₂O. The thermal cycling conditions used for PCR were as follows: 95°C for 30 seconds and 40 cycles of 5 seconds at 95°C and 30 seconds at 60°C. GAPDH was used as the internal control. All samples were measured in triplicate, and the PCR data were analyzed using the 2^-ΔΔCq method. The same methods were used for the 3 groups of samples.

To extract RNA, ciprofloxacin-resistant and intermediate strains were cultured in Nutrient broth for 24 h at 37 °C with sub-MIC concentrations of hydroalcoholic extract. Subsequently, RNA extraction was performed using Trizol (CinnaGen). Then, cDNA synthesis was performed using the Takara kit (Takara, Japan). Finally, concentration of extracted cDNA was determined by NanoDrop. qRT-PCR using a SYBR Green-containing Master Mix (Ampliqon, Denmark) was meant to evaluate the gene expression of the acrB efflux pump. Reagents in a final volume of 25 μL included 2 μL of extracted cDNA (100 ng), 10 picomoles of forward and reverse primers,, and 12.5 μL of SYBR Green-containing Master Mix. The temperature program of qPCR was 95 °C for 5 min, 95 °C for 30 sec, and 60 °C for 30 sec in 40 cycles. The 16S rRNA gene was used as internal control. Finally, the relative expression of the acrB gene was calculated by the ΔΔ_T method. Primers used in this section were acrB F 5′-TGAAGACCAGGGCGTATTCCT-3′ and acrB R 5′-TTTTTGCGTGCGCTCTTG-3′, as well as 16S rRNA F5’-CGTGTTGTGAAATGTTGGGTTAA-3’and16S rRNA R5’- CCGCTGGCAACAAAGGATAA -3 (13 (link)).

Total RNA was extracted from placental samples using TRIzol (Thermo Fisher Scientific Inc). Reverse transcription was achieved using Takara Kit (TaKaRa Biotechnology Co., Ltd.). cDNA amplification was then performed using SYBR Premix Ex Taq (TaKaRa) in a Roche 480 Light Cycler. PCR was carried out for 40 cycles according to the following procedure: 95°C for 30 seconds, annealing for 30 seconds, and 60°C for 34 seconds. Each sample was analyzed in duplicate. Relative mRNA expression levels of the target genes were calculated using the 2^−ΔΔCt method after normalization to GAPDH. The mRNA sequences used for PCR were as follows: IL‐34, 5′‐TTGACGCAGAATGAGGAGTG‐3′ (forward); 5′‐CCCTCGTAAGGCACACTGAT‐3′ (reverse); GAPDH, 5′‐CAGGAGGCATTGCTGATGAT‐3′ (forward); 5′‐GAAGGCTGGGGCTCATTT‐3′ (reverse).

To examine the mRNA expression of cardiac hypertrophy and fibrosis-related markers, total mRNA was collected using Trizol reagent (ThermoFisher Scientific, USA) according to the manufacturer's instructions. After the synthesis of the strand of cDNA using the Takara kit (RR036A, TaKaRa, China), qPCR was performed using the TB Green Premix Ex Taq (RR420A, TaKaRa, China). Each analysis was performed in three replicates, and the expression levels of target genes were normalized to GAPDH gene expression.