Nanodrop

After treatment, A549 cells were washed in tissue culture dish by adding cold PBS and rocking gently. Cells were washed directly in a culture dish by adding 1 ml of Trizol Reagent (Life technologies, cat. 10296–010) per 10 cm diameter dish and scraping with cell scraper. RNA was isolated according to the manufacturer's protocol. RNA concentration and purity was assessed using the nanophotomer NanodroP (Euroclone). RNA (400 ng) was subjected to reverse transcription reaction using the RT² first strand kit (Qiagen, cat.330401) according to the manufacturer's protocol.
To assess the expression of apoptotic genes, real-time quantitative reverse transcription PCR (qRT-PCR) was performed using the RT² Profiler PCR Arrays kit (Qiagen, cat.330231). Experiments were performed in triplicates for A549 cell line treated with PUAs at 5 µM concentration for 2 hours exposure time.
Plates were run on a ViiA 7 (Applied Biosystems 384 well blocks), Standard Fast PCR Cycling protocol with 10 µl reaction volumes. Cycling conditions used were – 1 cycle initiation at 95.0°C for 10 min and followed by amplification for 40 cycles at 95.0°C for 15 s and 60.0°C for 1 min. Amplification data were collected via ViiA 7 RUO Software (Applied Biosystems). The Ct-values were analyzed with PCR array data analysis online software (http://pcrdataanalysis.sabiosciences.com/pcr/arrayanalysis.php, Qiagen).

Viral DNA was extracted with a standard phenol/chloroform (Sigma) extraction protocol. DNA is quantified with Nanodrop (Euroclone) and analyzed by PCR. We used HotMasterMix from Quantabio, following the instructions of the manufacturer. Primers were synthesized by the DNA LAB facility at the CEINGE-Biotecnologie Avanzate:
Forward oligonucleotide -5’AAAACACCACCCTCCTTACCT3’-
Reverse oligonucleotide -3’GCTCCGTTCAAATCCTCTTCG5’ -.
Their complementary regions are at both ends of the transgene.

Total RNA was extracted from cell monolayers and from frozen renal tissues using the “Trizol” reagent (Invitrogen), according to the manufacturer’s instruction. Yield and purity were checked using Nanodrop (EuroClone) and total RNA from each sample was reverse transcribed into cDNA using SuperScript II Reverse Transcriptase (Invitrogen). Real-time PCR was performed on an ABI-Prism 7500 using Power SYBR Green Master Mix 2X (Applied Biosystems). The comparative Ct method (ΔΔCt) was used to quantify gene expression and the relative quantification was calculated as 2^-ΔΔCt. The presence of non-specific amplification products was excluded by melting curves analysis. The primers are listed in Table 1.