Bioscience influx sorter

Manufactured by BD

Sourced in United Kingdom

The BD Bioscience Influx sorter is a high-performance cell sorter. It is designed for accurate and efficient cell separation and isolation.

Automatically generated - may contain errors

Lab products found in correlation

96 well culture plate, by Greiner (1 mentions)

Close spelling variants of this product

BD Influx sorter

3 protocols using bioscience influx sorter

CRISPR-Mediated Genome Editing in Jurkat Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Jurkat cells were genome-edited by electroporation of the Cas9-crRNAtracrRNA complex using the Amaxa Nucleofector 2b electroporator. Donor vectors for genome-editing have homology arms ranging from 700–1000 bp, and were electroporated with the Cas9 complex. The gRNA sequence TTGCTTCCCGCTGCAAGCAG was used to target AP2M1, and the gRNA sequence CCTGCTCGACTAGGCCTCGA was used to target DNM2. Jurkat cells were cultured for 3 days after electroporation and sorted into 96-well plates for clonal expansion using fluorescent signal to isolate edited clones using the BD Bioscience Influx sorter (BD Bioscience). Both alleles of AP-2 and one allele of DNM2 were tagged in the final cell line.
The S. Pyogenes NLS-Cas9 was purified in the University of California Berkeley QB3 Macrolab. Sorting was conducted in the University of California Berkeley CRL flow cytometry facility.

Iwamoto Y., Ye A., Shirazinejad C., Hurley J.H, & Drubin D.G. (2023). Kinetic investigation reveals an HIV-1 Nef-dependent increase in AP-2 recruitment and productivity at endocytic sites. bioRxiv.

+ Open protocol

+ Expand

Clonogenic Potential of Progenitor Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

To test the ability of CPs to generate colonies starting from a single cell, CPs (n=4) at P5 were selected as Propidium Iodide negative (live cells) and sorted into single cells using a BD Bioscience Influx sorter (BD Biosciences, UK). Sorted cells were placed into each well of a 96-well culture plate (Greiner Bio-one, UK). The sorted cells were cultured up to 4 weeks in EGM-2 and the number of colonies generated was counted.

Avolio E., Rodriguez-Arabaolaza I., Spencer H.L., Riu F., Mangialardi G., Slater S.C., Rowlinson J., Alvino V.V., Idowu O.O., Soyombo S., Oikawa A., Swim M.M., Kong C.H., Cheng H., Jia H., Ghorbel M.T., Hancox J.C., Orchard C.H., Angelini G., Emanueli C., Caputo M, & Madeddu P. (2015). Expansion and Characterization of Neonatal Cardiac Pericytes Provides a Novel Cellular Option for Tissue Engineering in Congenital Heart Disease. Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease, 4(6), e002043.

+ Open protocol

+ Expand

Genome Editing of Jurkat Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Jurkat cells were genome-edited by electroporation of the Cas9-crRNAtracrRNA complex using the Amaxa Nucleofector 2 b electroporator. Donor vectors for genome-editing have homology arms ranging from 700–1000 bp, and were electroporated with the Cas9 complex. The gRNA sequence TTGCTTCCCGCTGCAAGCAG was used to target AP2M1, and the gRNA sequence CCTGCTCGACTAGGCCTCGA was used to target DNM2. Jurkat cells were cultured for 3 d after electroporation and sorted into 96-well plates for clonal expansion using fluorescent signal to isolate edited clones using the BD Bioscience Influx sorter (BD Biosciences). Both alleles of AP-2 and one allele of DNM2 were tagged in the final cell line.
The Streptococcus Pyogenes NLS-Cas9 was purified in the University of California Berkeley QB3 Macrolab. Sorting was conducted in the University of California Berkeley CRL flow cytometry facility.

Iwamoto Y., Ye A.A., Shirazinejad C., Hurley J.H, & Drubin D.G. (2023). Kinetic investigation reveals an HIV-1 Nef-dependent increase in AP-2 recruitment and productivity at endocytic sites. Molecular Biology of the Cell, 35(1), ar9.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!