Cfx384 qrt pcr machine

Total RNA from frozen tissues (liver, cortex, kidney) was isolated using TRIzol^® Reagent per the manufacturer’s instructions (Thermo Fisher; Waltham, MA) and quantified via Qubit assay as we have described previously [30 (link),33 (link),71 (link),72 (link),73 (link)]. First-strand complementary DNA (cDNA) was synthesized with random primers using Bio-Rad iScript cDNA Synthesis Kit. All qPCR reactions were then carried out using Bio-Rad SsoAdvanced SYBR Green mix on a Bio-Rad CFX384 qRT-PCR Machine. Gene expression was carried out in the liver, kidney, and cortex for IL6 (For—5′ AGTTGCCTTCTTGGGACTGA and Rev—5′ TCCACGATTTCCCAGAGAAC) TNF-α (For—5′ ATGAGAAGTTCCCAAATGGC and Rev—CTCCACTTGGTGGTTTGCTA) and IL-1β (For—5′ GCCCATCCTCTGTGACTCAT and Rev—5′ AGGCCACAGGTATTTTGTCG), and all data were normalized to Peptidylprolyl isomerase A (PPIA; For- 5′ GCGTCTSCTTCGAGCTGTT and Rev—5′ RAAGTCACCACCCTGGCA) using the ∆∆Ct method.

Total RNA from frozen tissues was isolated using the Trizol procedure as described previously (36 (link)). In brief, first-strand complementary DNA (cDNA) was synthesized with random primers and total RNA as a template using Biorad iScript cDNA Synthesis Kit. All qPCR reactions were carried out using Biorad Sso Advanced SYBR Green mix on a Biorad CFX384 qRT-PCR Machine. All data were then normalized to the housekeeping gene, 18S, using the delta delta Ct method. Primer sequences are provided in Supplementary Table 1.