Real-time PCR was performed on a Bio-Rad CFX touch 1000 qPCR system, and qPCR was carried out by using Bio-Rad CFX Manager software. The validated primers used are listed in Table S2. The housekeeping gene RPL13A (Curtis et al. 2010 (link)) and other validated primers were from Qiagen. The qPCR results were pooled for a gene study using Bio-Rad CFX Manager software.
Rq1 dnase kit
The RQ1 DNase kit is designed for the digestion of DNA in RNA samples. It contains a recombinant DNase I enzyme that efficiently removes contaminating DNA without affecting the integrity of the RNA.
Lab products found in correlation
12 protocols using rq1 dnase kit
RNA Extraction and qPCR Analysis
Real-time PCR was performed on a Bio-Rad CFX touch 1000 qPCR system, and qPCR was carried out by using Bio-Rad CFX Manager software. The validated primers used are listed in Table S2. The housekeeping gene RPL13A (Curtis et al. 2010 (link)) and other validated primers were from Qiagen. The qPCR results were pooled for a gene study using Bio-Rad CFX Manager software.
Quantitative Real-Time PCR Analysis of Gene Expression
Quantitative Real-Time PCR Analysis of Gene Expression
Quantification of Gene Expression in Plant Roots
The list of primers used in the qPCRs
Forward | Reverse | |
---|---|---|
PDC1 (Z66543) | ggactataccggctttgtgagtgc | accttcgcagtccagcatttcc |
PDC2 (Z66544) | atgcacaagcggtacccgag | tttctggccacatcgcagca |
ADH1 (X06281) | atggcaactacaagccccgc | agctccagctcccccttcat |
β-TUBULIN3 (X54846) | ttgggcgaaaggacactatactg | caacatcgaggaccgagtca |
qPCR Analysis of Fibronectin Expression
RNA Extraction and qPCR Analysis in Plants
Adipogenesis in Mouse 3T3-L1 Preadipocytes
Quantitative Real-Time PCR Analysis of Viral Genes
Nucleic Acid Extraction from Sediment
Transcriptome Analysis by Real-time qPCR
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!