Total protein was extracted from the cells and tissues using radioimmunoprecipitation assay (RIPA) lysis buffer (Biosharp). The extracted protein was denatured using loading buffer (R&D Systems). The protein sample was subjected to sodium dodecyl sulfate‐polyacrylamide gel electrophoresis (SDS‐PAGE) using a 10% gel. The resolved proteins were transferred onto a polyvinyl difluoride (PVDF) membrane (Millipore). The membrane was incubated with the following primary antibodies (all from Abcam) at 4°C overnight: anti‐GAPDH (ab181602), anti‐E‐cadherin (ab194982), anti‐vimentin (ab92547), anti‐N‐cadherin (ab18203), and anti‐Snail (ab229701). The membrane was washed three times with Tris‐buffered saline containing Tween‐20 (TBST). The membrane was then incubated with the secondary antibody at room temperature for 1 hour. The membrane was washed three times with TBST. The protein bands were visualized using enhanced chemiluminescence (ECL) solution.
Ab229701
Manufactured by Abcam
Sourced in United States
Ab229701 is a lab equipment product manufactured by Abcam. It is a scientific instrument designed for use in laboratory environments.
Automatically generated - may contain errors
Lab products found in correlation
Pvdf membrane, by Merck Group (3 mentions)
Ab194982, by Abcam (2 mentions)
Ab181602, by Abcam (2 mentions)
Ab175430, by Abcam (2 mentions)
Ab51772, by Abcam (2 mentions)
Bca protein assay kit, by Thermo Fisher Scientific (2 mentions)
Ecl kit, by Thermo Fisher Scientific (2 mentions)
Ripa buffer, by Thermo Fisher Scientific (2 mentions)
Ab18203, by Abcam (1 mentions)
Ab92547, by Abcam (1 mentions)
Ripa lysis buffer, by Biosharp (1 mentions)
Ab93926, by Abcam (1 mentions)
Ab220163, by Abcam (1 mentions)
Ab40772, by Abcam (1 mentions)
Ab137321, by Abcam (1 mentions)
Ab81046, by Abcam (1 mentions)
Ab195422, by Abcam (1 mentions)
Ab109201, by Abcam (1 mentions)
Ab150077, by Abcam (1 mentions)
Ab202030, by Abcam (1 mentions)
5 protocols using ab229701
1
Protein Extraction and Western Blot Analysis
2
Modulating YTHDF2 Expression in Gastric Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
YTHDF2 antibody (Abcam, ab220163), FOXC2 antibody (ab24340), GSK-3β antibody (Abcam, ab93926), and Snail antibody (Abcam, ab229701) were purchased from Abcam. Over-expressed YTHDF2 lentiviral plasmid was purchased from GeneCopoeia. The shYTHDF2 plasmid was commissioned by Shanghai Genechem Co., Ltd. The sequence of shYTHDF2 is as follows: shYTHDF2 # 1 CCGGGCTACTCTGAGGACGATATTCCTCGAGGAATATCG TCCTCAGAGTAGCTTTTTG; shYTHDF2 # 2 CCGGTACTG ATTAAGTCAGGATTAACTCGAGTTAATCCTGACTTAATCA GTATTTTTG. The lentiviral system was used to package YTHDF2 or shYTHDF2 lentiviral particles, and then virally infect the gastric cancer cell lines. The finally established overexpression or knockout YTHDF2 cell line had undergone long-term puromycin screening.
3
Western Blot Analysis of EMT and Exosome Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HCC cell lysate was centrifuged, and the protein supernatant was quantified using BCA Protein Assay kit (Thermo Fisher Scientific, Waltham, MA, USA). Equal amounts of protein samples (35 μg for protein detection of cell lysate; 20 μg for the detection of exosome markers) were separated using sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS‐PAGE) and transferred onto polyvinylidene difluoride (PVDF) membranes (Millipore, Billerica, MA, USA). The membranes were incubated with 5% nonfat milk to block the nonspecific sites, followed by incubation with the following primary antibodies at 4℃ overnight. Antibodies against Snail (ab229701; 1:500), Twist (ab175430; 1:1000), Vimentin (ab137321; 1:2000), E‐cadherin (ab40772; 1:40 000), CD9 (ab195422; 1:1000), CD81 (ab109201; 1:5000), LIMK1 (ab81046; 1:1000), and GAPDH (ab181602; 1:10 000) were purchased from Abcam (Cambridge, MA, USA). After washing, the secondary antibody (ab150077, Abcam) was incubated with the membranes. The protein signal was visualized by the enhanced chemiluminescence (ECL) system (Millipore).
4
Western Blot Analysis of Epithelial-Mesenchymal Transition Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Transfected HeLa or SiHa cells were isolated via RIPA lysis buffer (Invitrogen). Then, the BCA (Invitrogen) was employed to evaluate the concentration of protein. Proteins were separated by SDS-PAGE (Millipore, MA, USA), followed by transferred into PVDF membranes (Millipore). After being blocked with 5% nonfat milk, membranes were incubated overnight with primary antibodies at 4 °C: anti-Bax (ab32503, ABCAm), anti-Bcl-2 (ab182858, ABCAm), anti-SFN (ab14123, ABCAm) anti-E-cadherin (ab194982), anti-N-cadherin (ab202030), anti-Vimentin (ab193555), anti-ZEB1 (ab228986), anti-Slug (ab51772), anti-Twist (ab187008), anti-Snail (ab229701) and anti-GAPDH (ab8245, ABCAm), then cultivation at room temperature with secondary antibody for 1 h. GAPDH was employed as the internal parameter. Finally, the ECL Kit (Thermo Fisher Scientific) was selected to visualize protein bands.
5
Protein Isolation and Western Blot Analysis of CRC Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To isolate overall protein, CRC cells received lysing process with radioimmunoprecipitation assay (RIPA) buffer (89900; Thermo Scientific) containing phenylmethanesulfonyl fluoride (PMSF; Bestbio) and protease inhibitor cocktail (Bestbio, Shanghai, China). The protein samples were extracted using 10–12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and placed on nitrocellulose membranes, blocked with 5% skim milk at 4°C throughout the night, and subsequently cultured throughout the night with antibodies specific for YAP1 (1:1,000, ab52771, Abcam, Cambridge, MA, USA), CTGF (1:1,000, ab231824, Abcam); AREG (1:1,000, ab180722, Abcam); E-carherin (1:2,000, ab15148, Abcam); vimentin (1:2,000, ab8069, Abcam); Snail (1:1,000, ab229701, Abcam); Slug (1:1,000, ab51772, Abcam), and Twist (1:500, ab175430, Abcam). The membranes were subsequently cultivated with secondary goat anti-rabbit IgG antibody under conjugation with horseradish peroxidase (1:100, ab109489, Abcam) at 37°C for 1 h and then immersed in electro-chemiluminescence solution for imaging after which the relative protein levels were analyzed as previously described (17 (link)).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!