Ab3508

Double immunofluorescent labeling was used for determining the cellular localization of VDR or PDIA3/1,25MARRS protein. 3.7% paraformaldehyde was used for fixation, and then neurons were blocked with 30% goat serum in 0.02% T-PBS for 1 h at room temperature. After that, they were incubated with primary antibodies overnight at 4°C. They were further processed with corresponding secondary antibody labeled with Alexa Fluor 488 (A11034, ThermoFisher) in the dark for 1 h at room temperature. After labelling with the first primary antibody, another blocking step with 10% goat serum was performed. Blocking was then followed by incubation with the second primary antibody for 2 h at room temperature. Neurons were then labeled with corresponding secondary antibody tagged with Alexa Fluor 568 (ab175703, Abcam) for 1 h at room temperature. Primary antibodies for double immunofluorescent labeling were as follows: rabbit polyclonal antibody to VDR -ChIP Grade- (ab3508, Abcam) followed by mouse monoclonal antibody to PDIA3/1,25MARRS (Erp57/Grp58) (NBP2-36765, Novus). The Leica Application Suite Image Overlay Software (Leica Microsystems Ltd, Heerbrugg, GE) was used to obtain overlay images. Negative controls for immunofluorescent staining were also included by omitting primary antibodies.

1,25(OH)₂D₃ and 6-OHDA were purchased from Sigma-Aldrich (1,25(OH)₂D₃; 17936, 6-OHDA; H4381, Sigma-Aldrich, St. Louis, MO, USA). The following primary antibodies were used: rabbit antibody to tyrosine hydroxylase (TH) (NB300-109, 1:2000, Novus Biologicals, Littleton, CO, USA), rabbit antibody to GFAP (ab7260, 1:1000, Abcam, Cambridge, UK), rabbit antibody to CD31 (ab28364, 1:1000, Abcam, Cambridge, UK), mouse antibody to CD31 (#550274, 1:1000, BD biosciences, Franklin lakes, NJ, USA), rabbit antibody to VDR (ab3508, 1:1000, Abcam, Cambridge, UK), mouse antibody to P-gp (sc-55510, 1:1000, Santa Cruz, Dallas, TX, USA), mouse antibody to pS129-α-synuclein (#825701, Biolegend, San Diego, CA, USA), and mouse antibody to α-synuclein (BD-610787, BD Biosciences, Franklin lakes, NJ, USA).
The following secondary antibodies were used: biotin-conjugated goat antibody to rabbit IgG (cat# BA-1000, 1:1000, Vector Laboratories, Burlingame, CA, USA), Alexa fluor 568-conjugated donkey antibody to rabbit IgG (A10042, Invitrogen, Carlsbad, CA, USA), Alexa fluor 488-conjugated donkey antibody to mouse IgG (A21202, Invitrogen, Carlsbad, CA, USA), and Alexa Fluor 405-conjugated goat antibody to mouse IgG (A31553, Invitrogen).

Dental tissues were fixed by immersion in a 4% paraformaldehyde solution for 4 h. After washing in PBS, the samples were dehydrated in ethanol, rinsed in clearene (Leica-France) and paraffin-embedded (Paraplast plus, Sigma). Serial 8 μm sections were cut using a microtome (RM 2145, Leica, France). Sections were deparaffinized and rehydrated in decreasing concentrations of ethanol. Slices were microwaved for 20 min, and the tissues permeabilized with 0.5% Triton X-100 for 10 min. Sections were then washed in PBS and blocked with 10% normal goat serum in PBS for 1 h at room temperature. Slices were incubated overnight at 4°C with primary rabbit polyclonal anti-AR (N-20:sc-816, Santa Cruz) (1:200), anti-VDR (ab3508, Abcam) (1:500), or anti-ERα (sc-542, Santa Cruz) (1:50) antibodies. Sections were incubated with secondary goat anti-IgG coupled to Alexa Fluor 594 antibody (A-11072, Life Technologies) (1:500) at room temperature for one h in the dark. After rinsing with PBS, sections were immersed in DAPI (010M4003-Sigma) (1:100000) for 5 min and finally mounted with Fluoromount (Southern Biotech, Clinisciences).

The specificity of the anti-VDR antibody (ab3508, Abcam) which was used in immunofluorescent labeling and cell surface staining method, was checked with silencing of VDR expression via siRNA treatment in primary cortical neurons in our previous study [9 (link)]. The immune labeling of VDR protein in VDR silenced neurons was decreased almost 70% in ourprevious study [9 (link)]. This silencing efficiency was also consistent with mRNA and western blot results in our several studies [3 (link), 9 (link), 55 (link)]. Given the reliability of this anti-VDR antibody, it was chosen for cell surface staining method.

Chromatin immunoprecipitation (ChIP) assays were performed using the CHIP kit according to the manufacturer's instructions (Cell signaling technology, #9004, USA). VDR antibody was obtained from Abcam (ab3508). The ChIP primer sequence was designed by Primer Premier 5: Nrf2 sense 5′‐TGGGGCAGAGGTGTTTGAGC‐3′ and antisense 5′‐CCCTGGCTCTTTGAAGCAGTTTA‐3′. The relative binding of VDR to Nrf2 was determined through PCR by digital imaging system gel exposure on agarose gels.

Chromatin immunoprecipitation (ChIP) was performed using the ChIP kit (Millipore, USA) as previously described 33 (link). Briefly, human chondrocytes were treated with vehicle or 10^-7 M 1,25(OH)₂D₃ for 3 hours, and then cell samples were subjected to immunoprecipitation using either a control IgG or rabbit anti-VDR antibody (Abcam, ab3508). The co-precipitated chromatin was determined by qPCR for the presence of human Sirt1 promoter sequence using Sirt1 sense 5′-TTAGAGTGGCTTACAGGC-3′ and antisense 5′-ACATCTTCTGGCTTCCTT-3′ primers.