Tb green premix ex taq 2

Manufactured by Takara Bio

Sourced in Japan, China, United States, Switzerland, Germany, Singapore, Australia

TB Green Premix Ex Taq II is a ready-to-use solution for real-time PCR amplification. It contains a DNA polymerase, dNTPs, buffer, and TB Green dye for detection of double-stranded DNA products.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (467 mentions) Primescript rt reagent kit, by Takara Bio (406 mentions) Primescript rt master mix, by Takara Bio (294 mentions) Primescript rt reagent kit with gdna eraser, by Takara Bio (261 mentions) Rnaiso plus, by Takara Bio (143 mentions) Trizol, by Thermo Fisher Scientific (143 mentions) Steponeplus real time pcr system, by Thermo Fisher Scientific (83 mentions) Rneasy mini kit, by Qiagen (74 mentions) Nanodrop 2000, by Thermo Fisher Scientific (74 mentions) Trizol reagent, by Takara Bio (68 mentions) Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (61 mentions) Mir x mirna first strand synthesis kit, by Takara Bio (50 mentions) Cfx96 real time pcr detection system, by Bio-Rad (38 mentions) Lightcycler 480 system, by Roche (35 mentions) Rnaiso plus reagent, by Takara Bio (34 mentions) Cfx96 real time system, by Bio-Rad (32 mentions) Minibest universal rna extraction kit, by Takara Bio (31 mentions) Lightcycler 96 system, by Roche (30 mentions) Primescript 2 1st strand cdna synthesis kit, by Takara Bio (30 mentions) Lightcycler 480, by Roche (29 mentions)

1 992 protocols using tb green premix ex taq 2

Quantifying Lung COPD Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols

To further validate differential mRNA expression from lung tissues in the COPD rats, the total RNA was extracted form lung tissue using trizol reagent and RNA was converted to cDNA using PrimeScript™ RT Master Mix (Takara). Quantitative PCR (qPCR) was performed using TB green premix Ex Taq II (Takara), according to the manufacturer's protocol, cDNA samples, appropriate primers, and TB green premix Ex Taq II (Takara), ROX Reference Dye (50×, ddH2O. Primers used for qPCR were as follows: as follows: NXT1, forward 5-CTTTGTCAGCTCCGTCTTCA-3, reverse5-CTCAAGGCCTTCTCCAGT TC-3; PLA2G2A, forward 5-GCACA GTTGGCAACCTTTATG-3, reverse 5-CCATCAGCATCATACACTCCTC3; GAPDH, forward 5-AACTCCCATTC CTCCACCTT -3, reverse 5-GAGGGCCTCTCTCTTGCTCT-3. The thermal cycling conditions included initial incubation of samples at 95 C for 30 s, followed by appropriate cycles of 95 C for 5 s, 60 C for 30 s. GAPDH used as an internal control, and relative expression levels were determined using the 2 − ΔΔCt method.

Mohammadtursun N., Li Q., Abuduwaki M., Jiang S., Zhang H., Sun J, & Dong J. (2020). Loki zupa alleviates inflammatory and fibrotic responses in cigarette smoke induced rat model of chronic obstructive pulmonary disease. Chinese Medicine, 15, 92.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of CeqMYB Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from roots using the Aidlab plant RNA kit (Aidlab Biotech, Beijing, China) based on specifications. The integrity and concentration of the RNA was verified by 1% agarose gel electrophoresis and NanoDrop™ One/OneC (ThermoFisher Scientific, USA). The first strand cDNA was synthesized by PrimerScript RT MasterMix (Takara, Tokyo, Japan) according to the manufacturer’s instructions. qRT-PCR was performed on an LightCycler480 II Real-Time PCR system (Made in Switzerland) using TB Green Premix Ex Taq II (TaKaRa Biotechnology Co. Ltd., Dalian, China) with a 20 μL sample volume. And each reaction mixture contained 2.0 μl of diluted cDNA, 0.8 μl of each primer, 10.0 μl of TB Green Premix Ex Taq II, and 6.4 μl of RNase-free water. qPCR reaction cycling conditions were set as per the manufacturer’s instructions for TB Green Premix Ex Taq II. Each sample was conducted three times biologically using replicate. The relative expression level of each gene was calculated as 2^-ΔΔCT [60 (link)] compared with untreated control plants that were set as 1. Specific primers for CeqMYB genes were designed by Primer Premier 5.0 software and the EF1α was used as housekeeping gene [61 (link)]. Statistical analysis and drawing by GraphPad 8 software [62 ].

Wang Y., Zhang Y., Fan C., Wei Y., Meng J., Li Z, & Zhong C. (2021). Genome-wide analysis of MYB transcription factors and their responses to salt stress in Casuarina equisetifolia. BMC Plant Biology, 21, 328.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total hepatic RNA was extracted using Sepasol-RNA (Nacalai Tesque, Inc., Kyoto, Japan)
and reverse-transcribed to cDNA using PrimeScript RT Master Mix (Takara Bio Inc., Shiga,
Japan) and TaKaRa PCR Thermal Cycler Dice Touch (Takara Bio Inc.). After the reaction,
cDNA samples were diluted five times with sterile water and subjected to reverse
transcription-quantitative PCR (RT-qPCR) using TB Green Premix Ex Taq II (Takara Bio Inc.)
and a Thermal Cycler Dice Real Time System II (Takara Bio Inc.). The samples were
amplified using TB Green Premix Ex Taq II (Takara Bio, Inc.). All procedures were
performed in accordance with the manufacturer’s protocol. The fold-changes in gene
expression relative to the levels obtained in the control group, which were set to 1, were
analyzed and calculated using the 2-ΔΔCt method. Primer sequences used for qPCR are listed
in Table 3Table 3. Gene-specific Primers.

Uno K., Miyajima K., Ogawa S., Suzuki-Kemuriyama N, & Nakae D. (2022). Effects of Siraitia grosvenorii extract on nonalcoholic steatohepatitis-like lesions in Sprague Dawley rats fed a choline-deficient, methionine-lowered, l-amino acid-defined diet. Journal of Toxicologic Pathology, 36(1), 1-10.

+ Open protocol

+ Expand

TRPA1 Expression Analysis by qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

The expression of TRPA1 in all experiments was analyzed by quantitative real-time PCR (qRT-PCR), which performed in triplicate using the Applied Biosystem 7500 Real-time system (Applied Biosystem, Foster, CA, USA). According to the manufacturer’s instructions, the reaction volume was 20 μL containing 2 μL of 1:5 dilution cDNA, 6 μL Nuclease-free Water, 10 μL TB Green Premix Ex Taq II, 0.4 μL of ROX Reference Dye II (TB Green™ Premix Ex Taq™ II; TaKaRa, Dalian, China), 0.4 μM of each primer (Table 1). The qRT-PCR program included 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s, and 60 °C for 32 s. Amplification products were analyzed by melting curve at the end of each PCR to confirm amplification specificity. In this study, 18S rRNA gene was used as the reference gene [34 (link),35 (link)]. The relative expression level of TRPA1 was calculated using the comparative Ct method (2⁻^△△CT method) [36 (link)].

Ding J., Wang H., Li Z., Sun J., Ding P., Chi X., Yang M., Chang Y, & Zhao C. (2022). Digestive Enzyme Activities and Gut Emptying Are Correlated with the Reciprocal Regulation of TRPA1 Ion Channel and Serotonin in the Gut of the Sea Urchin Strongylocentrotus intermedius. Biology, 11(4), 503.

+ Open protocol

+ Expand

Quantitative Analysis of Gene Expression in Rhabdomyosarcoma

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from rhabdomyosarcoma cell lines using an RNeasy mini kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. cDNA was synthesized using a SuperScript VILO cDNA synthesis kit (Invitrogen) according to the manufacturer’s instructions. qRT-PCR was carried out in a 7300 Real time PCR System (Applied Biosystems, Carlsbad, CA) with TB Green Premix Ex Taq II (Clontech Laboratories, Madison, WI) according to the manufacturer’s protocol. The PCR primers used in the study were as follows: for GAPDH: 5′-GCACCGTCAAGGCTGAGAAC-3′ (forward) and 5′-ATGGTGGTGAAGACGCCAGT-3′ (reverse); for PAX3-FOXO1: 5′-TCCAACCCCATGAACCCC-3′ (forward) and 5′-GCCATTTGGAAAACTGTGATCC-3′ (reverse); for B7-H3: 5′-CAAGGCAATGCATCCCTGAG-3′ (forward) and 5′-CTTCGAGTAGGGAGCGGC-3′ (reverse); for MYOG: 5′-GGACGGAGCTCACCCTGA-3′ (forward) and 5′-TTACACACCTTACACGCCCA-3′ (reverse). The levels of target mRNAs were determined using the delta delta CT method and were normalized to the expression level of GAPDH. All experiments were performed in triplicate.

Kanayama T., Miyachi M., Sugimoto Y., Yagyu S., Kikuchi K., Tsuchiya K., Iehara T, & Hosoi H. (2021). Reduced B7-H3 expression by PAX3-FOXO1 knockdown inhibits cellular motility and promotes myogenic differentiation in alveolar rhabdomyosarcoma. Scientific Reports, 11, 18802.

+ Open protocol

+ Expand

RNA Extraction and qPCR for OSC and Fly Ovaries

Check if the same lab product or an alternative is used in the 5 most similar protocols

For OSC, RNA extraction and cDNA preparation were performed with SuperPrep II Cell Lysis & RT kit for qPCR from 1.0 × 10⁵ OSC. For fly ovaries, total RNA extraction was performed with ISOGEN II (Nippon Gene: 311-07361) and cDNA was synthesized with Transcription First Strand cDNA Synthesis Kit (Roche 04379012001). TB Green Premix Ex Taq II (Clontech) was used for quantitative PCR with indicated qPCR primers (Supplementary Table S1).

Takeuchi C., Yokoshi M., Kondo S., Shibuya A., Saito K., Fukaya T., Siomi H, & Iwasaki Y.W. (2022). Mod(mdg4) variants repress telomeric retrotransposon HeT-A by blocking subtelomeric enhancers. Nucleic Acids Research, 50(20), 11580-11599.

+ Open protocol

+ Expand

Quantitative Analysis of mRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

For mRNA gene expression, 1 μg of purified RNA was reverse-transcribed with OneScript® cDNA Synthesis Kit (Applied Biological Materials Inc., Canada) according to the manufacturer’s instructions. qPCR reactions were conducted in a Rotor Gene Q 5plex HRM apparatus (Qiagen, Germany) in a 10 μl total reaction volume using TB Green Premix Ex Taq II (Clontech Laboratories, USA) according to the manufacturer’s instructions. Each reaction was run in triplicate and always included a no-template control. The mRNA expression of the genes of interest was calculated using GAPDH as the reference gene.
mRNA expression levels were analysed by the 2^−ΔCt method. The value of the relative expression of the genes of interest is given as mean ± standard deviation (SD) of three independent experiments.
The primers sequences (written 5ʹ-3ʹ) were: p16, Fw: CATAGATGCCGCGGAAGGT, Rv: CTAAGTTTCCCGAGGTTTCTCAGA; IL-1β, Fw: CCAGCTACGAATCTCCGACC, Rv: TGGGGTGGAAAGGTTTGGA; IL-6, Fw: CCAGCTACGAATCTCCGACC, Rv: CATGGCCACAACAATGACG; IL-8, Fw: TCTGCAGCTCTGTGTGTGAAGG, Rv: TGGGGTGGAAAGGTTTGGA; β-actin, Fw: TGCTATCCCTGTACGCCTCT, Rv: GTGGTGGTGAAGCTGTAGCC; DNMT1, Fw: AGAACGCCTTTAAGCGCCG; Rv: CCGTCCACTGCCACCAAAT; SIRT1, Fw: AGGCCACGGATAGGTCCATA; Rv: GTGGAGGTATTGTTTCCGGC. Primer concentration was 200 nM.

Mensà E., Guescini M., Giuliani A., Bacalini M.G., Ramini D., Corleone G., Ferracin M., Fulgenzi G., Graciotti L., Prattichizzo F., Sorci L., Battistelli M., Monsurrò V., Bonfigli A.R., Cardelli M., Recchioni R., Marcheselli F., Latini S., Maggio S., Fanelli M., Amatori S., Storci G., Ceriello A., Stocchi V., De Luca M., Magnani L., Rippo M.R., Procopio A.D., Sala C., Budimir I., Bassi C., Negrini M., Garagnani P., Franceschi C., Sabbatinelli J., Bonafè M, & Olivieri F. (2020). Small extracellular vesicles deliver miR-21 and miR-217 as pro-senescence effectors to endothelial cells. Journal of Extracellular Vesicles, 9(1), 1725285.

+ Open protocol

+ Expand

Quantifying SENP2 Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from patients sample was extracted by using Trizol reagent (Invitrogen, Carlsbad, CA, USA) and cDNA libraries were prepared by following standard procedures. Then Q-PCR analysis was performed to detect gene expression levels using TB Green Premix Ex Taq II(Clontech, Dalian, China) in 7500 fast system. The primer sequence sets of SENP2 used are SENP2-F, 5′CAGAGACGATGGTCGGAATCAG3′, SENP2-R, 5′CCTCCTGAGTAAGCCATTGCTTC3′. The GAPDH primers sequence used are GAPDH-F, 5′GTCTCCTCTGACTTCAACAGCG3′, GAPDH-R, 5′ACCACCCTGTTGCTGTAGCCAA3′. The relative expression level of SENP2 was determined by 2^−ΔΔCT value. The experiment is performed in triplicates and the average values are represented as a fold change in gene expression. The significance was determined by the T-Test and represented as p-value.

Xie H., Gu Y., Wang W., Wang X., Ye X., Xin C., Lu M., Reddy B.A, & Shu P. (2020). Silencing of SENP2 in Multiple Myeloma Induces Bortezomib Resistance by Activating NF-κB Through the Modulation of IκBα Sumoylation. Scientific Reports, 10, 766.

+ Open protocol

+ Expand

Quantifying Cell Cycle Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

OneScript® cDNA Synthesis Kit was used to reverse-transcribe 1 μg of purified RNA according to the manufacturer’s instructions. qPCR reactions were conducted on the Rotor Gene Q 5plex HRM apparatus in a 10 μl total reaction volume using TB Green Premix Ex Taq II (Clontech Laboratories) according to the manufacturer’s recommendations. Each reaction was run in triplicate and included no-template controls. The mRNA expression of the genes of interest was calculated using GAPDH as the reference gene.
Relative mRNA levels were calculated with the 2^−ΔCt method. Relative expression values were reported as mean ± SD of three independent experiments.
Primer sequences (written 5ʹ-3ʹ) were: PCNA, Fw: CGGATACCTTGGCGCTAGTA, Rv: CACAGCTGTACTCCTGTTCTGG; Cyclin D1, Fw: CCCTCGGTGTCCTACTTCAA, Rv: AGGAAGCGGTCCAGGTAGTT; Cyclin A, Fw: TTGAAGAAATATACCCCCCAG, Rv: AATGATTCAGGCCAGCTTTG; Cyclin B1, Fw: TTGGTGTCACTGCCATGTTT, Rv: TAAGCAAAAAGCTCCTGCTG.

+ Open protocol

+ Expand

Gene Expression Analysis in Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from tissue was extracted using RNAiso Plus (Code No. 9108, TAKARA) and reverse transcribed into complementary DNA (cDNA) with a cDNA synthesis kit (RR047A, TAKARA Bio Inc.). Subsequently, TB Green™ Premix Ex Taq™ II (RR820A, Clontech Laboratories, Inc., A TaKaRa Bio Company) was used to quantify the mRNA expression levels on the Opticon® System (Bio-Rad, Hercules, CA). Primers for genes of interest were designed and synthesized by TaKaRa, and the sequences were as follows: TRPA1-F 5′-CAGCGGTTCTTCTTGTGAAGTG-3′, TRPA1-R 5′-GTTTGGGTTTGGATGCTTTGTTG-3′; GAPDH-F 5′-GAGAAA-CCGGCCAAATACGA-3′, GAPDH-R 5′-GTAAGAAGGTGAAAACTGCGAC-3′; SP-F 5′-GACCAGATCAAGGAGGCGCT-3′, SP-R 5′-TACCCGTTTTGCCCTACGACT-3′. GAPDH served as the internal reference, and the fold changes were calculated using the 2-ΔΔCt method.

Zou B., Cao C., Fu Y., Pan D., Wang W, & Kong L. (2022). Berberine Alleviates Gastroesophageal Reflux-Induced Airway Hyperresponsiveness in a Transient Receptor Potential A1-Dependent Manner. Evidence-based Complementary and Alternative Medicine : eCAM, 2022, 7464147.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!