Based on the SNP/InDel detection, the Chl-R, Tet-R and Amp-R mutants as well as WT E. coli were tested relatively genes expression by RT-qPCR. The strains were cultured in liquid LB with 0.8MIC0 of respective antibiotics (Chl for the Chl-R mutant, Tet for the Tet-R mutant, Amp for the Amp-R mutant) at 37 °C and 150 rpm for 6 h. Bacteria in logarithmic growth were harvested by centrifugation. The total RNA was extracted using a RNAprep Pure Cell/Bacteria Kit (Tiangen, China). RNA samples were converted to cDNA with a FastKing RT Kit (Tiangen, China). RT-qPCR was performed using SuperReal PreMix (SYBR Green) (Tiangen, China) with transcribed cDNA templates on StepOnePlus™ Real-Time PCR System (Applied Biosystems, USA) following the instruction. The primers were listed in the Table S2. The relative expression was calculated by the 2-△△Ct method and the results were showed as log2 fold change (LFC) (Livak and Schmittgen, 2001 (link)). All experiments in this study were carried out with independent biological replicates and repeated at least 3 times.
Superreal premix sybr green
Manufactured by Tiangen Biotech
Sourced in China, United States
SuperReal PreMix SYBR Green is a ready-to-use solution for real-time quantitative PCR (qPCR) experiments. It contains SYBR Green I dye, DNA polymerase, dNTPs, and necessary buffers and additives for efficient amplification and detection of target DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (22 mentions)
Trizol, by Thermo Fisher Scientific (16 mentions)
Applied biosystems 7500 fast real time pcr system, by Thermo Fisher Scientific (15 mentions)
Revertaid reverse transcriptase, by Thermo Fisher Scientific (13 mentions)
Fastquant rt kit, by Tiangen Biotech (8 mentions)
Amplification primers, by Thermo Fisher Scientific (6 mentions)
Quantscript rt kit, by Tiangen Biotech (4 mentions)
Rnaprep pure cell bacteria kit, by Tiangen Biotech (3 mentions)
7500 fast real time pcr system, by Thermo Fisher Scientific (3 mentions)
Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (3 mentions)
Ultrospec 2100 pro, by GE Healthcare (2 mentions)
Iqtm5, by Bio-Rad (2 mentions)
Fastquant rt kit with gdnase, by Tiangen Biotech (2 mentions)
Abi prism 7500, by Thermo Fisher Scientific (2 mentions)
Bulge loop mirnaqrt pcr primer kit, by RiboBio (2 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions)
Fastking rt kit, by Tiangen Biotech (1 mentions)
Rnasimple total rna kit, by Tiangen Biotech (1 mentions)
60 protocols using superreal premix sybr green
1
Relative Gene Expression in Antibiotic-Resistant E. coli
2
Quantifying VCL mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293T cells transfected with empty vector, wild‐type or variant VCL plasmids were collected at 24 hr after transfection. RNA simple Total RNA Kit (TIANGEN; DP419) was used for RNA extraction, and then cDNA reverse transcription was performed using the FastQuant RT kit (TIANGEN; KR106). Q‐RT‐PCR was carried out on CFX96 (Bio‐Rad) using Super Real PreMix SYBR Green (TIANGEN; FP205). VCL mRNA levels were normalized by GAPDH. Primers used for qRT‐PCR are listed in Table S1 . Three independent experiments were performed and each group was analyzed in triplicate.
3
RT-PCR and qRT-PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from target tissues using Trizol reagent (Invitrogen, Carlsbad, CA, USA), following the manufacturer’s protocol. Reverse transcription was performed using the Quant cDNA Synthesis Kit (Tiangen, Beijing, China) with 1 µg of unpurified total RNA as a template in a 20 μL total volume.
RT-PCR (Promega, Madison, WI, USA) was used to assess the temporal and spatial expression profiles of LmigCSPIII. Primers used are shown inTable 1 . The thermal cycling conditions for RT-PCR were as follows: 45 min at 45 °C and 3 min at 95 °C; followed by 30 cycles of 30 s at 95 °C, 30 s at 55 °C and 45 s at 68 °C. The reaction was completed with 10 min at 68 °C.
Both RT-PCR and qRT-PCR were used to determine RNA interference efficiency. Primers for qRT-PCR were specifically designed (Table 1 ). The actin gene was used as an endogenous control to correct for sample-to-sample variation. The 20 μL reaction system included 10 μL SuperReal PreMix SYBR Green (Tiangen, Beijing, China), 0.6 μL qRT-PCR Sense Primer, 0.6 μL qRT-PCR Antisense Primer, 1 μL synthesized cDNA, 2 μL ROX and 5.8 μL RNase-free H2O (Tiangen). The thermal cycling conditions for qRT-PCR were 15 min at 95 °C; followed by 40 cycles of 10 s at 95 °C, 20 s at 58 °C and 31 s at 72 °C. Each sample reaction was repeated three times and the results were averaged.
RT-PCR (Promega, Madison, WI, USA) was used to assess the temporal and spatial expression profiles of LmigCSPIII. Primers used are shown in
Both RT-PCR and qRT-PCR were used to determine RNA interference efficiency. Primers for qRT-PCR were specifically designed (
4
Gene Expression Analysis in Neural Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol (Life Technologies) reagent and reverse-transcribed to cDNA using oligo(dT). Specific gene expression was quantified with SuperReal PreMix SYBR Green (TIANGEN) using an Applied Biosystems 7500 fast real-time PCR system (Life Technologies). The following amplification primers (Life Technologies) were used (5′ to 3′): GFAP (sense, ACATCGA GATCGCCACCTACA; antisense, GTCTGCACGGGAATGGTGAT), S100B (sense, GGAGACGGCGAATGTGACTT; antisense, GAACTCGTGGCAGGCAGTAGTAA), MAP2 (sense, GGGCCTTTTCTTTGAAATCTAGTTT; antisense, CAAA TGTGGCTCTCTGAAGAACA), TUBB3 (sense, GGCCAAGGGTCACTACACG; antisense, GCAGTCGCAGTTTTCACACTC), NEUN (sense, CCCATCCCGACTTACGGAG; antisense, GCTGAGCGTATCTGTAGGCT), GALC (sense, GCCAAGCGTTACCATGATTTG; antisense, CCACCTTGAAGAGTTCGGCA), MOG (sense, AGAACGCTACAGGCATGGAG; antisense, CAGGGCTCACCCAGTAGAAAG), NES (sense, CTGCTACCCTTGAGACACCTG; antisense, GGGCTCTGATCTCTGCATCTAC), SOX9 (sense, CGAAATCAACGAGAAACTGGAC; antisense, ATTTAGCACACTGATCACACG), PGC1α (sense, AAAGGATGCGCTCTCGTTCA; antisense, CTTCAGCCTCTCGTGCTGAT), PGC1β (sense, GAGGTGGACGAGCTCTCACT; antisense, GGGTGTCAGAGCTTGATGTT), and PRC (sense, CTTCCTGCCTACCCCACGTA; antisense, CTCCTGGGGAATGTCAACGC).
5
Quantitative Analysis of Protein-Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To further understand the relationship between proteins and their encoding genes, qPCR was run for proteins of differential hepatic abundance at the mRNA level. Specific primers for target genes of the identified proteins were designed using the primer BLAST of NCBI and nucleotide information in GenBank (Additional file 2 : Table S2). Total RNA was prepared from the liver of control and treated groups using TRNzol-A+ (TIANGEN, Beijing, China). RNA quality and concentration were detected using spectrophotometer (Ultrospec 2100 pro, GE Healthcare) and agarose gel electrophoresis. cDNA synthesis with 5 μg of RNA was performed using the Fast Quant RT Kit (with gDNase) (TIANGEN). qPCR was conducted using the iCycler iQ5 system. The PCR was performed in a 20-μL reaction system containing 1 μL of cDNA, 0.5 μL of each primer (10 μM), 10 μL of Super Real PreMix (SYBR Green) (TIANGEN) and 8.2 μL of water. The fold-change was calculated using the IQTM5 software (Bio-Rad) with the 2 −ΔΔCt method [25 (link)]. All operation for qPCR was followed by the MIQE [26 (link)].
6
Quantifying Gene Expression in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of cells was extracted using the TRIzol® reagent (Invitrogen, 15596), followed by reverse transcription using oligo (dT) and RevertAid Reverse Transcriptase (Thermo Fisher Scientific, EP0442). Real-time PCR was performed with SuperReal PreMix SYBR Green (Tiangen, FP205) with a 7500 Fast Real-Time PCR System (Applied Biosystems, USA). The relative mRNA expression level was calculated and analyzed by the comparative Ct method (RQ = 2−∆∆Ct). The sequences of primers are listed as follows.
β-Actin (human): forward: 5′-GATTCCTATGTGGGCGACGA-3′ and reverse: 5′-AGGTCTCAAACATGATCTGGGT-3′
NR4A3 (human): forward: 5′-AGCGGCGGCATCCTC-3′ and reverse: 5′-CTAAGGGTCCAGGCTCAGG-3′
SMARCB1 (human): forward: 5′-ACCTAACACTAAGGATCACGGA-3′ and reverse: 5′-CATCCACACCAAAGGGGGAA-3′
β-Actin (rat): forward: 5′-CGCGAGTACAACCTTCTTGC-3′ and reverse: 5′-CGTCATCCATGGCGAACTGG-3′
NR4A3 (rat): forward: 5′-GGAAACGTGGCGACATCCT-3′ and reverse: 5′-CAGTGGGCTTTGGGTTCTGTG-3′
SMARCB1 (rat): forward: 5′-AGCTGAACATCCATGTGGGG-3′ and reverse: 5′-GTGGGTTCTCACTGAAGGCA-3′
7
RNA Extraction and RT-qPCR Analysis of HCC Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from HCC cell lines and fresh tumor tissues using TRIzol Reagent (Thermo Scientific, USA) according to the manufacturer’s protocol. A total of 2 μg RNA was reverse-transcribed to cDNA with Oligo(dT) (synthesized by Life Technologies), and RevertAid Reverse Transcriptase (Thermo Scientific). Expression of specific genes was calculated by the comparative cycle threshold method using SuperReal PreMix SYBR Green (FP204-02; TIANGEN) in an Applied Biosystem 7500 Fast RT-PCR system (Life Technologies). Primer sequences are shown in the Supplementary material .
8
Telomere Length Quantification by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from the PBMCs isolated from whole blood using TIANamp Genomic DNA Kit (Tiangen, Beijing, China). DNA concentration was measured using the microplate reader. Samples were diluted to a final concentration of 25 ng/1.5 µL to measure telomere length. qPCR was performed using SuperReal PreMix (SYBR Green) (Tiangen, Beijing, China). Primers used were as follows: forward TEL 5′-GGT TTT TGA GGG TGA GGG TGA GGG TGA GGG TGA GGG t-3′, reverse TEL 5′-TCC CGA CTA TCC CTA TCC CTA TCC CTA TCC CTA TCC CTA-3′, forward AT1 5′-ACG TGT TCT CAG CAT CGA CCG CTA CC-3′, and reverse AT1 5′-AGA ATG ATA AGG AAA GGG AAC AAG AAG CCC-3′. The relative telomere length was measured by comparing the ratio of telomere repeat copy number (T as Tel1) and single gene copy number (S as AT1), expressed as telomere length (T/S) ratio. Each individual value obtained by qPCR was processed through the formula T/S = 2−∆Ct, where ΔCT = CTtelomere − CTAT1. This ratio was then compared with the ratio of the reference DNA. Each DNA sample collected was measured in duplicate.
9
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Eight right back skin tissue samples were randomly selected from the H and L groups for qPCR analysis. Twelve DEGs were selected for qPCR. Specific primers for gene amplification are shown in Supplementary Table S1 and were designed using Primer 3 Input. Total RNA was reverse-transcribed using a Fast Quant RT Kit (TIANGEN BIOTECH (Beijing) Co., Ltd., Beijing, China according to the manufacturer’s instructions. SuperReal PreMix SYBR Green (TIANGEN BIOTECH (Beijing) Co., Ltd., Beijing, China) was applied to perform the qPCR reaction with an ABI Prism 7500 instrument (Applied Biosystems, Carlsbad, CA, USA). Relative gene expression levels were determined by using the 2–ΔΔCt method with the GAPDH gene for normalization [32 (link)].
10
Quantitative RT-PCR Analysis of Viral Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted using TRIzol reagent (Life Technologies), and reverse transcription was performed with 3 μg of total RNA using oligo(dT) and RevertAid Reverse Transcriptase (Thermo Scientific), according to the manufacturer’s instructions. Gene amplification was performed with SuperReal PreMix SYBR Green (TIANGEN) using an Applied Biosystems 7500 Fast Real-Time PCR System (Life Technologies), and the expression levels of all the genes were normalized to those of β-actin. Primers for each exon region of ZAP, NS1, and β-actin have been reported26 (link).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!