Mlv reverse transcriptase

To examine I-I/R associated lung and intestinal inflammation, lung and intestinal mRNA expression of IL6, TNF-α, IL-1 β, and MIP-2 were assessed. Total RNA was extracted from tissue using Trizol reagent (Invitrogen, Carlsbad, CA). cDNA was synthesized using MLV reverse transcriptase (Applied Biosystems, Foster City, CA). PCR reactions were carried out in 20 μl of a final volume of 0.05 μM of each forward and reverse primer, water, cDNA, and SYBR Green PCR master mix (Applied Biosystems). Amplification was conducted in a Step One Plus real-time PCR machine (Applied Biosystems). Mouse β-actin mRNA was used as an internal control for amplification and relative gene expression levels were calculated using the ΔΔCT method. Relative expression of mRNA was expressed as fold change in comparison with sham tissues that were standardized to one. The sequence of primers for this study is listed as follow: IL-6 (NM_031168), forward (CCGGAGAGGAGACTTCACAG) and reverse (CAGAATTGCCATTGCACAAC); IL-1β (NM_008361), forward (CAGGATGAGGACATGAGCACC) and reverse (CTCTGCAGACT-CAAACTCCAC); MIP-2 (NM_009140), forward (CCCTGGTTCAGAAAATCATCCA) and reverse (GCTCCTC-CTTTCCAGGTCAGT), TNF-α (NM_012675), forward (AGACCCTCACACTCAGATCATCTTC) and reverse (TTG CTACGACGTGGGCTACA), and β-actin (NM_007393), forward (CGTGAAAAGATGACCCAGATCA) and reverse (TGGTACGACCAGAGGCATACAG).

Total RNA was extracted from a total of 5 × 10⁵ peritoneal macrophages stimulated with NETs (1000 ng/mL) or rhNE (1000 ng/mL) for 1 h. After stimulation of the cells with NETs or rhNE, mRNA was isolated using Trizol reagent (Invitrogen, Carlsbad, CA) and assessed the expression of integrins α_v, β_3, β₅ using RTqPCR. cDNA was synthesized using MLV reverse transcriptase (Applied Biosystems, Foster City, CA). PCR reactions were carried out in 20 μl of a final volume of 0.08 μM of each forward and reverse primer (Supplemental Table 1), cDNA, water, and SYBR Green PCR master mix (Applied Biosystems). Amplification and analysis was conducted in a Step One Plus real-time PCR machine (Applied Biosystems). Mouse β-actin mRNA was used as an internal control for amplification and relative gene expression levels were calculated using the ΔΔCT method. Relative expression of mRNA was expressed as fold change in comparison with PBS-treated cells.

Kidneys were harvested at 24 hours following reperfusion and stored at −80°C. Approximately 100 mg of tissue powder was lysed using sonication and provided lysis buffer from Illustra RNAspin Mini RNA Isolation kit (GE Healthcare) according to manufacturer instructions. Total tissue RNA was extracted using the same kit. RNA was subsequently reversed-transcribed into cDNA using MLV reverse transcriptase (Applied Bio- systems, Thermo Fisher Scientific). The PCR reaction was performed in a final volume of 24 μL containing 4 βg cDNA, 0.08 μmol of forward and reverse primers, 10 μL SYBR Green PCR Master Mix (Applied Biosystems), and 11 μL nuclease-free water. cDNA was amplified using a Step One Plus real-time PCR machine (Applied Biosystems, Thermo Fisher Scientific). Mouse β-actin was used for normalization and relative expression of mRNA was calculated using the ΔΔCT method. Results were reported as fold change in comparison with the sham mice. Primer sequences are: β-actin: Forward: CGTGAAAAGATGACCCAGATCA, Reverse: TGGTACGACCAGAGGCATACAG, TREM-1: Forward: CTACAACCCGATCCCTACCC, Reverse: AAACCAGGCTCTTGCTGAGA, IL-6: Forward: CCGGAGAGGAGACTTCACAG, Reverse: CAGAATTGCCATTGCACAAC, NGAL: Forward: CTCAGAACTTGATCCCTGCC, Reverse: TCCTTGAGGCCCAGAGACTT