Log In Sign up
The largest database of trusted experimental protocols

Pgl3 enhancer

Manufactured by Promega
Visit Supplier
Sourced in United States

PGL3-enhancer is a plasmid vector that contains an SV40 enhancer sequence to increase transcription and expression levels in a variety of mammalian cell lines. This vector can be used for reporter gene assays and gene expression studies.

Automatically generated - may contain errors

Lab products found in correlation

Luciferase assay system, by Promega (3 mentions) Lipofectamine 3000, by Thermo Fisher Scientific (3 mentions) Pmd2 g, by Addgene (2 mentions) Dual luciferase reporter assay system, by Promega (2 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions) Dual luciferase assay system, by Promega (1 mentions) Pwpxl plasmid, by Addgene (1 mentions) Polybrene, by Merck Group (1 mentions) Pspax2, by Addgene (1 mentions) Dual light assay system, by Thermo Fisher Scientific (1 mentions) Dual luciferase reporter assay, by Promega (1 mentions) Prl sv40, by Promega (1 mentions) Pcmvr8, by Addgene (1 mentions) Pcw57 mcs1 p2a mcs2, by Addgene (1 mentions) Pcr2.1 topo plasmid, by Thermo Fisher Scientific (1 mentions) Hepg2, by American Type Culture Collection (1 mentions) Hek293t, by American Type Culture Collection (1 mentions) Prl tk, by Promega (1 mentions) Prl tk vector, by Promega (1 mentions) Pgl3 enhancer vector, by Promega (1 mentions)

Close spelling variants of this product

PGL3.0-enhancer PGL3-Enhancer plasmid PGL3-enhancer vector PGL3-enhancer reporter vector

15 protocols using pgl3 enhancer

1

Transcriptional Regulation of SNEP1 by Gli2

Check if the same lab product or an alternative is used in the 5 most similar protocols
In silico analysis of transcription factor Gli2-binding sites in the human SNEP1 5ʹ-upstream region (−1062 to +971) was performed by using Genomatix MatInspector software (http://www.genomatix.de/). To construct the reporter vector for the luciferase assay, the 5ʹ-fragment of human SNEP1 containing Gli2-binding sites was amplified via PCR and cloned into the firefly luciferase reporter plasmid pGL3-Enhancer (Promega, Madison, WI, USA). Cloned promoter sequences were validated via Sanger DNA sequencing. The primers used for the luciferase reporter constructs are listed in Appendix Table S4. For the luciferase reporter assays, the pGL3-Enhancer-Luc reporter plasmids (0.2 μg/well) and the internal control plasmid pRL-TK (5 ng/well) were transfected into HEK-293T cells. The constructs of Myc-Gli2, shRNAi-Gli2, or empty vector (0.4 μg/well) were cotransfected for 24 h, and reporter gene activity was assayed using the Dual Luciferase Assay System (Promega) in accordance with the manufacturer’s protocol. All experiments comprised three biological replicates.
Yan Z., Cheng M., Hu G., Wang Y., Zeng S., Huang A., Xu L., Liu Y., Shi C., Deng L., Lu Q., Rao H., Lu H., Chen Y.G, & Luo S. (2021). Positive feedback of SuFu negating protein 1 on Hedgehog signaling promotes colorectal tumor growth. Cell Death & Disease, 12(2), 199.
+ Open protocol
+ Expand
2

GRHPR Promoter Cloning and Mutagenesis

Check if the same lab product or an alternative is used in the 5 most similar protocols
1.3 kb of the human GRHPR promoter sequence (inclusive of the 5′ UTR and translational start site) was amplified from anonymized human genomic DNA using Bgl2- and Ncol-tailed primers and sub-cloned into Ncol- and Bgl2-cleaved and gel-purified pGL3-Enhancer (Promega Corporation). This vector was selected because it has an SV40 enhancer downstream of the luciferase reporter. Mismatches introduced through this cloning strategy were corrected via mutagenesis to reconstitute the wild-type human GRHPR start site context (sequence convention as above): TCCGGGTCGGCGGCTGCACTGCGGATGAGagacgccaaaaacataaagaaag. We call this plasmid hGRHPR-1321ATG-Enh-WT, abbreviated -1321ATG-WT, which was then mutagenized to the variant context (TCCGGGTCGGCGGCTGCACTATGGATGAGagacgccaaaaacataaagaaag) to create plasmid hGRHPR-1321ATG-Enh-Var (abbreviated -1321ATG-Var). hGRHPR cDNA was mutagenesized to introduce the patient p.Gln232Argfs*3 (c.694delC) mutation, sequence-confirmed, and subjected to functional testing.
Fu Y., Rope R., Fargue S., Cohen H.T., Holmes R.P, & Cohen D.M. (2014). A mutation creating a highly active out-of-frame alternative translation initiation site within the 5′ UTR of the GRHPR gene causing primary hyperoxaluria type II. Clinical genetics, 88(5), 494-498.
+ Open protocol
+ Expand
3

Luciferase Assay for miR-200a Targets

Check if the same lab product or an alternative is used in the 5 most similar protocols
The luciferase reporter assay was performed as previously described (22 (link)). The 3′-UTR sequence of miR-200a target genes (CTNNB1, CDH1, PTEN, APC, CTNNA1 and SOD2) was separately amplified and inserted into the luciferase reporter vector pGL3-enhancer (Promega Corporation). The primers of the 3′-UTR of miR-200a target genes were designed and are presented in Table SII. A total of 1×104 KYSE150 cells/well were seeded into 24-well plates and incubated for 24 h at 37°C. Wild-type or mutant miR-200a target gene 3′-UTR vectors, combined with the miR-200a mimic, were subsequently co-transfected into KYSE150 cells using Lipofectamine® 3000 (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. The construction of the miR-200a target genes' 3′-UTR wild-type or mutant reporter genes were performed using the miRNA databases (Fig. S1). Following incubation for 48 h at 37°C, KYSE150 cells were lysed and firefly and Renilla luciferase activity was detected using a Luciferase assay system (Promega Corporation), according to the manufacturer's protocol. Firefly luciferase activity was normalized to Renilla luciferase activity.
Yang B., Liu Y., Li L., Deng H, & Xian L. (2020). MicroRNA-200a promotes esophageal squamous cell carcinoma cell proliferation, migration and invasion through extensive target genes. Molecular Medicine Reports, 21(5), 2073-2084.
+ Open protocol
+ Expand
4

RNA-seq and Luciferase Assay Protocol

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA of kidney samples from different groups were prepared for RNA-sequencing as we previously reported 35 (link), 36 (link). Sequencing and analysis were performed by Novogene (Beijing, China). qPCR and Western blots were performed as we previously described 37 (link). Primers and antibodies used are provided in Tables S1 and S2. For reporter assay, promoter region of Il-6 from -2000 to +500 of TSS (transcription start site) was cloned into pGL3-enhancer (Promega, Madison, WI). Five pGL3-Il-6 luciferase reporter plasmids were constructed by inserting different regions of the Il-6 promoter into pGL3-enhancer vector. NRK52E cells were transfected with indicated plasmids, luciferase assays were performed and analyzed as we previously described 38 (link).
Wang J., Xiong M., Fan Y., Liu C., Wang Q., Yang D., Yuan Y., Huang Y., Wang S., Zhang Y., Niu S., Yue J., Su H., Zhang C., Chen H., Zheng L, & Huang K. (2022). Mecp2 protects kidney from ischemia-reperfusion injury through transcriptional repressing IL-6/STAT3 signaling. Theranostics, 12(8), 3896-3910.
+ Open protocol
+ Expand
5

Luciferase Assay for VEGFA 3'-UTR

Check if the same lab product or an alternative is used in the 5 most similar protocols
The luciferase reporter assay was conducted as described previously (21 (link)). The 3′-untranslated region (UTR) sequence of VEGFA was amplified and inserted into the luciferase reporter vector pGL3-enhancer (Promega Corporation, Madison, WI, USA). The primers for VEGFA 3′-UTR were 5′-CAGCTCGAGTGTGTGAGTGGTTGACCTTCCT-3′ (forward) and 5′-CCGAAGCTTTCAGGGAGAGAGAGATTGGAAA-3′ (reverse). HTR-8/SVneo cells were seeded into 24-well plates (5×105 cells/well) and incubated for 24 h. Wild-type or mutant VEGFA 3′-UTR vectors were subsequently co-transfected with the miR-203 mimic into HTR-8/SVneo cells using Lipofectamine 3000 (Invitrogen; Thermo Fisher Scientific, Inc.). After incubation for 48 h, cells were lysed and assayed for luciferase activity with the Luciferase Assay System (Promega Corporation) according to the manufacturer's instructions. Renilla-luciferase was used for normalization.
Liu F., Wu K., Wu W., Chen Y., Wu H., Wang H, & Zhang W. (2018). miR-203 contributes to pre-eclampsia via inhibition of VEGFA expression. Molecular Medicine Reports, 17(4), 5627-5634.
+ Open protocol
+ Expand
6

Cloning and Lentiviral Transduction

Check if the same lab product or an alternative is used in the 5 most similar protocols
The full-length human CD24A and CD24B open reading frame cDNA sequences were separately amplified and cloned into a pWPXL plasmid (Addgene, Cambridge, MA, USA) using BamHI and EcoRI. The full-length human EGR1 open reading frame cDNA sequence was amplified and cloned into pWPXL using MluI and EcoRI. The CD24A promoter, which spans a 2,100 bp-region (−1,900 bp to +200 bp based on the first ATG), and mutant were separately cloned into PGL3-Enhancer (Promega Corporation, Fitchburg, WI, USA). The primer sequences are listed in Table S1.
For lentivirus production and cell transfection, after co-transfection of HEK 293 T cells with the pWPXL-CD24A vector, pWPXL-CD24B vector or pWPXL-EGR1 vector with psPAX2 and pMD2.G (Addgene) using Lipofectamine 2000 (Thermo Fisher Scientific) for 48 hours, viruses were harvested and used to infected target cells in the presence of 6 µg/mL polybrene (Sigma-Aldrich Co.).
Li L., Chen J., Ge C., Zhao F., Chen T., Tian H., Li J, & Li H. (2019). CD24 isoform a promotes cell proliferation, migration and invasion and is downregulated by EGR1 in hepatocellular carcinoma. OncoTargets and therapy, 12, 1705-1716.
+ Open protocol
+ Expand
7

Regulation of FOS gene by miR-196b

Check if the same lab product or an alternative is used in the 5 most similar protocols
miRWalk2.0 was used to identify candidate genes regulated by miR-196b and to localize putative binding sites within the 3′UTR of the FOS gene (21 (link)). PITA, RNA22, and RNAhybrid 2.2 algorithms were used to localize putative binding sites for miR-196b within the FOS promoter and 5′UTR (−1500bp to translation start site +250bp) (22 (link)–24 (link)). The FOS promoter regions and the 3′UTR of the FOS gene were amplified by PCR and inserted into the pGL3-enhancer (Promega, Madison, WI) vector or pMIR-REPORT firefly Luciferase vector system (Life Technologies), respectively. The Luciferase vectors were co-transfected with either the pMIR-REPORT β-galactosidase reporter control vector or pRL Renilla (Promega) for normalizing transfection efficiency and miR-196b mimic or control mimic (Life Technologies) using Lipofectamine 3000. Luciferase and β-galactosidase activities are determined with the Dual-Light assay system (Life Technologies) and Luciferase and Renilla activities were determined by Dual-Luciferase reporter assay (Promega). The 3xAP-1pGL3 (3xAP-1 in pGL3-basic) was a gift from Alexander Dent (Addgene plasmid # 40342) (25 (link)). The AP-1 reporter plasmid was co-transfected with pRL Renilla for normalization. Reporter assays were performed in three independent experiments.
Tellez C.S., Juri D.E., Do K., Picchi M.A., Wang T., Liu G., Spira A, & Belinsky S.A. (2016). MiR-196b is epigenetically silenced during the pre-malignant stage of lung carcinogenesis. Cancer research, 76(16), 4741-4751.
+ Open protocol
+ Expand
8

Luciferase Reporter Assay for SREBP

Check if the same lab product or an alternative is used in the 5 most similar protocols
The reporter gene plasmids including human SREBP‐1c‐luc, SREBP‐2‐luc (including three canonical SREBP‐1c ‐response elements [SRE]) and the SRE mutant promoter of SREBP‐1c‐luc and SREBP‐2‐luc in the luciferase reporter vector pGL3‐Enhancer (Promega) were previously described.23, 24 The FAS‐Luc and HMGCR‐Luc reporter plasmid were previously reported.25, 26 Cells were plated on 12‐well plates and transfected with indicated luciferase vectors and Renilla luciferase plasmid pRL‐SV40 (Promega) as an internal control, the ratio of luciferase vector and Renilla plasmid was 50:1. The transcriptional activity was determined using a luciferase assay system (Promega).
Shu Z., Gao Y., Zhang G., Zhou Y., Cao J., Wan D., Zhu X, & Xiong W. (2019). A functional interaction between Hippo‐YAP signalling and SREBPs mediates hepatic steatosis in diabetic mice. Journal of Cellular and Molecular Medicine, 23(5), 3616-3628.
+ Open protocol
+ Expand
9

Establishment of Cell Lines and Plasmids

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human liver carcinoma cell line HepG2, the murine skeletal muscle cell line C2C12, and human embryonic kidney (HEK293T) cells were obtained from the American Type Culture Collection (ATCC, LGC Standards, Molsheim, France). The luciferase reporter gene plasmid pGL3-enhancer and pGL3-control, and Renilla luciferase internal control plasmid pRL-TK, were purchased from the Promega Corporation (Promega, Madison, WI, USA). Pc DNA-PGC1α and pc DNA-MEF2D were purchased from Addgene (Watertown, MA, USA). The pCR2.1-TOPO plasmid was from Invitrogen (Basel, Switzerland). The plasmids pMD2.G (Addgene #12259), pCMVR8.74 (Addgene #22036), and pCW57-MCS1-P2A-MCS2 (Addgene #80921) were from Addgene (Watertown, MA, USA).
Novakova K., Török M., Panajatovic M., Bouitbir J., Duong F.H., Handschin C, & Krähenbühl S. (2022). PGC-1α and MEF2 Regulate the Transcription of the Carnitine Transporter OCTN2 Gene in C2C12 Cells and in Mouse Skeletal Muscle. International Journal of Molecular Sciences, 23(20), 12304.
+ Open protocol
+ Expand
10

Evaluating NF-κB Responsiveness of HLA Promoters

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
To determine the NF-κB responsiveness of HLA promoters, we generated reporter constructs expressing firefly luciferase under the control of the HLA-B or HLA-C promoter. HLA-B and HLA-C promoter sequences were amplified from genomic DNA (gDNA) of mucous membrane cells obtained by buccal swabs (primer HLA-B/C_fw CCAGGAGGAGAAGTGAAGGGG]) and inserted into pGL3-enhancer (Promega) via KpnI/XhoI. A previously described NF-κB reporter vector served as a control (76 (link)). HEK293T cells were cotransfected with 0.2 μg of the firefly luciferase reporter construct and 0.1 μg of a Gaussia luciferase vector under the control of the pTAL promoter for normalization. All transfections were performed in 96-well plates, in triplicates, using the calcium phosphate method. NF-κB signaling was activated by the cotransfection of a constitutively active mutant of IκB kinase β (IKKβ) (0.8 μg). At 40 h posttransfection, a dual-luciferase assay was performed, and the firefly luciferase signals were normalized to the corresponding Gaussia luciferase control values.
Hopfensperger K., Richard J., Stürzel C.M., Bibollet-Ruche F., Apps R., Leoz M., Plantier J.C., Hahn B.H., Finzi A., Kirchhoff F, & Sauter D. (2020). Convergent Evolution of HLA-C Downmodulation in HIV-1 and HIV-2. mBio, 11(4), e00782-20.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!