miR-376c was inserted into the pGL3 plasmid (Promega, Madison, WI, USA). The
YTHDF1-3’UTR-mutant (MUT) fragment of the binding site mutation was constructed
by point mutation method using point mutation kits (Robustnique Corporation
Ltd., Tianjin, China). “UAUUUGUACUUUUUCUAUGUA” was mutated to
“UAUAUCUCAAUUAGAUACAA” on the YTHDF1-3’UTR and inserted into the pGL3 plasmids
to construct the YTHDF1-MUT. The indicated plasmids and Renilla plasmid were
introduced with miR-376c mimic or NC-mimic into HEK293 T cells (American Type
Culture Collection, Manassas, VA, USA). Cells were lysed following 48 h of
transfection under the instructions of a luciferase detection kit (K801-200,
BioVision, Inc., Exton, PA, USA). Dual-luciferase reporter gene assays were
carried out with the help of the Dual-Luciferase Reporter Assay System
(Promega). Renilla activity served as the internal control.