Log In Sign up
The largest database of trusted experimental protocols

Myiq2 themocycler

Manufactured by Bio-Rad
Visit Supplier

The MyiQ2 Thermocycler is a real-time PCR detection system designed for gene expression analysis, SNP genotyping, and pathogen detection. It features a peltier-based temperature control system and a sensitive detection system for reliable and accurate results. The MyiQ2 supports a range of sample volumes and plate formats to accommodate diverse research needs.

Automatically generated - may contain errors

Lab products found in correlation

Power sybr green pcr master mix, by Bio-Rad (2 mentions) Trizol, by Thermo Fisher Scientific (2 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)

2 protocols using myiq2 themocycler

1

qRT-PCR Analysis of Ccl2 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cell mRNAs were extracted in TRIzol (Invitrogen), and reverse transcribed using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Target cDNAs were amplified with Power SYBR Green PCR Master Mix (Bio-Rad) and real time cycle thresholds were detected via MyiQ2 themocycler running on an iQ5 software (Bio-Rad). Target genes fold induction were calculated using the 2−ΔΔCt method by normalizing cycle thresholds to the Hprt housekeeping gene and medium controls (Livak and Schmittgen, 2001 (link)). Verified Ccl2 primer sequences were acquired from the PrimerBank (Harvard Medical School, Massachusetts General Hospital and The Center for Computational and Integrative Biology), and commercially synthesized (Integrated DNA Technologies). Ccl2 forward primer sequence (5′ to 3′): TTAAAAACCTGGATCGGAACCAA, and reverse primer sequence (5′ to 3′): GCATTAGCTTCAGATTTACGGGT.
Hou X., Chen G., Bracamonte-Baran W., Choi H.S., Diny N.L., Sung J., Hughes D., Won T., Wood M.K., Talor M.V., Hackam D.J., Klingel K., Davogustto G., Taegtmeyer H., Coppens I., Barin J.G, & Čiháková D. (2019). The Cardiac Microenvironment Instructs Divergent Monocyte Fates and Functions in Myocarditis. Cell reports, 28(1), 172-189.e7.
+ Open protocol
+ Expand
2

qRT-PCR Analysis of Ccl2 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cell mRNAs were extracted in TRIzol (Invitrogen), and reverse transcribed using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Target cDNAs were amplified with Power SYBR Green PCR Master Mix (Bio-Rad) and real time cycle thresholds were detected via MyiQ2 themocycler running on an iQ5 software (Bio-Rad). Target genes fold induction were calculated using the 2−ΔΔCt method by normalizing cycle thresholds to the Hprt housekeeping gene and medium controls (Livak and Schmittgen, 2001 (link)). Verified Ccl2 primer sequences were acquired from the PrimerBank (Harvard Medical School, Massachusetts General Hospital and The Center for Computational and Integrative Biology), and commercially synthesized (Integrated DNA Technologies). Ccl2 forward primer sequence (5′ to 3′): TTAAAAACCTGGATCGGAACCAA, and reverse primer sequence (5′ to 3′): GCATTAGCTTCAGATTTACGGGT.
Hou X., Chen G., Bracamonte-Baran W., Choi H.S., Diny N.L., Sung J., Hughes D., Won T., Wood M.K., Talor M.V., Hackam D.J., Klingel K., Davogustto G., Taegtmeyer H., Coppens I., Barin J.G, & Čiháková D. (2019). The Cardiac Microenvironment Instructs Divergent Monocyte Fates and Functions in Myocarditis. Cell reports, 28(1), 172-189.e7.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!