Cas9 protein and sgRNA or scramble sgRNA were mixed in 1:1 molar ratio (Synthego Corporation) and incubated at 37 °C for 10–15 min. 1e6 of either primary CD8+ T cells or MM.1S cell line were spun down and washed with PBS, resuspended in 20 μL of P3 nucleofection/solution plus cas9/sgRNA mixture (P3 Primary Cell 4D-NucleofectorTM X Kit S) for primary T cells or SF Cell Line 4D-NucleofectorTM X Kit S (Lonza) for MM.1S cell lines, and nucleofected using EO-115 or DS-137 nucleofection program in Lonza 4D-Nucleofector, respectively. 80 µL of warm (CTS™ OpTmizer™ T Cell Expansion SFM, Gibco™) or RPMI 1640 media (Gibco) was plated into each well and incubated at 37 °C for 15 min, then transferred to a 6-well plate supplemented with IL-7 and IL-15 for T-CD8+ T cells to recover for 48 h. Then, based on the surface expression by flow cytometry, negative clones were sorted using FACSARIA II flow cytometer (BD Biosciences). sgRNA sequences were obtained from Brunello Library65 (link) as follows: CCR10: CTGTCGCCTCATCTTCCCCG, TATCAGCGCCGACCGCTACG; CD53: CCGTTACCACTCAGACAATA, EVI2B: CAACTGTCAAAAATTCACCT; CD50 (ICAM3): CGGGGACACGCTAACGGCCA. Negative Control, scrambled sgRNA#1 and #2 mod-sgRNA specified by Synthego Corporation.
Cts optmizer t cell expansion sfm
Manufactured by Thermo Fisher Scientific
Sourced in United States
The CTS OpTmizer T Cell Expansion SFM is a serum-free medium designed for the expansion of T cells in cell therapy and research applications. The product provides a defined, animal component-free formulation to support the growth and proliferation of T cells.
Automatically generated - may contain errors
Lab products found in correlation
Interleukin 2 (il 2), by Thermo Fisher Scientific (5 mentions)
Rpmi 1640 media, by Thermo Fisher Scientific (2 mentions)
P3 primary cell 4d nucleofectortm x kit s, by Lonza (2 mentions)
Sf cell line 4d nucleofectortm x kit s, by Lonza (2 mentions)
Lysis buffer, by Cell Signaling Technology (2 mentions)
Na3vo4, by Roche (2 mentions)
Recombinant human il 2, by Thermo Fisher Scientific (2 mentions)
Easysep human t cell isolation kit, by STEMCELL (2 mentions)
X vivo 15, by Lonza (2 mentions)
Phosphate buffered saline (pbs), by Thermo Fisher Scientific (2 mentions)
Facsaria 2 flow cytometer, by BD (1 mentions)
Anti cd3 cd28 dynabeads, by Thermo Fisher Scientific (1 mentions)
Facsaria fusion, by BD (1 mentions)
Facsaria 3, by BD (1 mentions)
Dynabeads mouse t activator cd3 cd28, by Thermo Fisher Scientific (1 mentions)
Glutamax, by Thermo Fisher Scientific (1 mentions)
Glutamine, by Thermo Fisher Scientific (1 mentions)
Streptomycin, by Thermo Fisher Scientific (1 mentions)
Rhil 2, by BD (1 mentions)
Optmizer t cell expansion supplement, by Thermo Fisher Scientific (1 mentions)
20 protocols using cts optmizer t cell expansion sfm
1
CRISPR Knockout of T Cell Targets
2
Starved cell stimulation and immunoblotting
3
Starved cell stimulation and immunoblotting
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ba/F3 cells were starved of serum and interleukin 3 (IL3) for two hours, followed by stimulation with 1ng/ml IL3 or 5ng/ml interferon gamma (IFNy). Xenograft T-ALL samples were freshly collected from NSG mice, starved in CTS OpTmizer T Cell Expansion SFM (Gibco) for 2.5 hours, drug or DMSO was added for 30 minutes, followed by 30 minutes stimulation with 10ng/ml hIL7. Cells were lysed in lysis buffer (Cell Signaling Technology) with addition of 5mM Na3VO4 and protease inhibitors (Complete, Roche) and processed for immunoblotting.
4
Expansion and Transduction of Human T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
De-identified, HLA typed and purified human CD4 and CD8 T cells were obtained from the University of Pennsylvania’s CFAR and Human Immunology Core (HIC RRID: SCR_022380). Both subsets of T cells were cultured in CTS OpTmizer T-cell expansion SFM(Gibco) with 1% Penicillin-Streptomycin, 2mM GlutaMax and 25mM HEPES buffer, and 100U/ml IL-2 at 1x106 cells per ml. Cell culture flasks were incubated at 37° C, 5% CO2 and 95% humidity. T cells were stimulated with anti-CD3/CD28 Dynabeads (Life Technology) at 3:1 ratio. 18 hours after stimulation, appropriate amount of CAR or TCR lentiviruses were added into the culture of CD8 T cells. 48 hours after stimulation, the culture volume was quadrupled with culture medium. At 4 days after activation, the anti-CD3/CD28 beads were removed using a magnet. Throughout the culture after bead removal, medium was supplied every 2 days to maintain a cell concentration of 0.5x106 cells per ml.
5
CRISPR-Cas9 Genome Editing in T Cells and Multiple Myeloma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cas9 protein and sgRNA or scramble sgRNA were mixed in 1:2.5 molar ratio (Synthego Corporation) and incubated at 37 °C for 10–15 min. 1e6 of either primary CD3+ T cells or MM cell lines were spun down and washed with PBS, resuspended in 20 μL of P3 nucleofection/solution plus cas9/sgRNA mixture (P3 Primary Cell 4D-NucleofectorTM X Kit S) for primary T cells or SF Cell Line 4D-NucleofectorTM X Kit S (Lonza) for MM cell lines, and nucleofected using EO-115 or DS-137 nucleofection program in Lonza 4D-Nucleofector, respectively. 80 μL of warm (CTS™ OpTmizer™ T Cell Expansion SFM, Gibco™) or RPMI 1640 media (Gibco) was plated into each well and incubated at 37 °C for 15 min, then transferred to a 12-well plate supplemented with IL-7 and IL-15 for T-CD3+ T cells and 6-well plate for cell lines to recover. Then, based on the surface expression by flow cytometry, negative clones were sorted using FACSARIA-Fusion or FACSARIA III flow cytometer (BD Biosciences). sgRNA sequences were obtained from Brunello Library(56 (link)) as follows: CD70: CAGCTACGTATCCATCGTGA, AGCGCUGGATGCACACCACG; TFAP2A: AUCCUCGCAGGGACUACAGG; CD27: AGUGUGAUCCUUGCAUACCG. sgRNA sequence for TNFRSF17 (BCMA) was obtained through from Synthego Corporation tool: GGUGUGACCAAUUCAGUGAA. Negative Control, scrambled sgRNA#1 and #2 mod-sgRNA specified by Synthego Corporation.
6
Expanding CAR-T Cells from PBMCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human peripheral blood mononuclear cells (PBMCs) from healthy adult donors were purchased from the Abramson Cancer Center’s Human Immunology Core. CD3+ T cells were isolated from PBMCs using the EasySep Human T Cell Isolation Kit (STEMCELL Technologies), following the manufacturer’s instructions. Cells were placed in Opt5 media [5% heat-inactivated GemCell Human Serum AB (Gemini Bio) and 2 mM GlutaMAX (Gibco) in CTS OpTmizer T Cell Expansion SFM (Gibco)] at a concentration of 1 × 106 cells/ml and activated with Dynabeads Mouse T-Activator CD3/CD28 (Gibco) at a ratio of 3:1 beads to cells and human recombinant IL-2 (100 IU/ml; PeproTech Inc.). One day after activation, cells were infected with CAR19 containing lentivirus at an MOI of 2. On days 5, 7, 9, and 12, cells were counted using a Countess automated cell counter; then, Opt5 with IL-2 was added to bring the cell concentration down to 5 × 105 cells/ml. Cells were harvested on day 14.
7
Rapid Expansion of Polyclonal T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Polyclonal T cells from freshly isolated PBMC (from healthy blood donors) were isolated using Dynabeads Untouched T cells Kit (Life Technologies) and activated ex vivo using OKT3 (30 ng ml−1, eBioscience, San Diego, CA, USA), pooled irradiated feeder cells (1:100) and high dose IL-2 according to the rapid expansion protocol described by Rosenberg lab (Dudley et al.). Cells were seeded 1 × 105 T cell ml−1, 5 × 107 irradiated feeder cells ml−1 in cell culture media with 3000 U ml−1 IL-2 (Life Technologies) in tissue culture wells and grown for 2 weeks. Cell cultures were fed with fresh media every 1–3 days as needed. Media used were XVIVO-15 (Lonza), CTS OpTmizer T cell Expansion SFM, or AIM-V CTS (Life Technologies). Pooled human AB serum (2 or 5% as indicated) or 10% CTS Immune Cell SR were added to the media for comparison. All cell culture media were supplemented to a final concentration of 6 mm glutamine (Life Technologies). At the end of culture, cells were counted and phenotype was analysed using flow cytometer (CD4, CD8 and CD62L).
8
Expansion and Enrichment of PBMCs
9
Restimulation of Differentiated TH17 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In-vitro differentiated TH17 cells were rested on a plate without anti-CD3/anti-CD28 for overnight and re-stimulated with plate-bound anti-CD3/anti-CD28 in serum free medium (CTS™ OpTmizer™ T-Cell Expansion SFM, Life Technologies) in the presence or absence of 10 ng ml−1 IL-23. The resulting cells were used for indicated assays to measure the expression of cytokine and signal proteins and TH17 signature mRNAs.
10
Expansion and Transduction of Primary T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Peripheral blood mononuclear cells (PBMCs) obtained from de-identified healthy donors at Gulf Coast Regional Blood Center (Houston, TX) were isolated from leukapheresis products by Ficoll-Paque (Cytiva, Marlborough, MA) gradient centrifugation. T cells were then negatively selected by the EasySep™ Human T Cell Isolation Kit (STEMCELL Technologies, Vancouver, Canada). These cells were activated by anti-CD3/CD28-coated beads (Life Technologies, Carlsbad, CA) at a cell-to-bead ratio of 1:3 with 200 U/ml of IL-2 (PeproTech, London, UK) in CTS™ OpTmizer™ T Cell Expansion SFM (Life Technologies). After 24–48 h of activation, cells were transduced by the addition of high-titer lentiviral particles expressing CD38-CAR, CD19-CAR, or green fluorescent protein (GFP). Transduced T cells were maintained at a concentration of 0.7 × 106 cells/ml for 7–10 days by cell enumeration every 2–3 days. Finally, the T cells were induced to proliferate using a previously described rapid expansion protocol (REP) [18 ].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!