Total RNA was isolated from cell lines using RNA isolation kit (Bio‐Rad, München, Germany). Total RNA (1 μg) was treated with DNase using DNase I Amplification Grade kit (AMPD1; Sigma, ?St. Louis, MO, USA) and used for cDNA synthesis using mRNA first‐strand cDNA synthesis kit (Bio‐Rad). The resulting cDNA products were stored at −20 °C. qPCR was performed using Cdh23 specific primers (Tables S1 and S2 ) in the CFX96 Real‐Time PCR Detection System (Bio‐Rad).
Rna isolation kit
Manufactured by Bio-Rad
Sourced in Germany
The RNA isolation kit is a laboratory product designed to extract and purify ribonucleic acid (RNA) from various biological samples. The kit provides a standardized protocol and the necessary reagents to efficiently isolate high-quality RNA for downstream applications such as gene expression analysis, reverse transcription, and RNA sequencing.
Automatically generated - may contain errors
Lab products found in correlation
Cdna synthesis kit, by Bio-Rad (3 mentions)
Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (3 mentions)
Model 6000 nano kit, by Agilent Technologies (2 mentions)
Hiseq 4000, by Illumina (2 mentions)
A11122, by Thermo Fisher Scientific (2 mentions)
Hpa017232, by Merck Group (2 mentions)
Pa5 43398, by Thermo Fisher Scientific (2 mentions)
Cfx96, by Bio-Rad (2 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (1 mentions)
D1152, by Merck Group (1 mentions)
His tag, by Roche (1 mentions)
Reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Abi 7500 pcr system, by Thermo Fisher Scientific (1 mentions)
Tri reagent, by Merck Group (1 mentions)
Agilent bioanalyzer, by Agilent Technologies (1 mentions)
Quantitect sybr green, by Qiagen (1 mentions)
Hplc grade acetonitrile ch3cn, by Merck Group (1 mentions)
Milli q system, by Merck Group (1 mentions)
Methanol, by Merck Group (1 mentions)
Dnase 1 kit, by Merck Group (1 mentions)
10 protocols using rna isolation kit
1
RNA Isolation, cDNA Synthesis, and qPCR for Cdh23 Gene Expression
2
Comprehensive RNA-seq Workflow for Nerve Tissue
3
Western Blotting and qRT-PCR of Cadherin-23
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The adherent cancer cell lines HeLa, HEK293, A549, and HaCaT were obtained from NCCS, Pune. All cells were cultured in high glucose DMEM media (D1152, Sigma-Aldrich) containing 10% FBS and 5% CO2. We followed the standard protocol50 (link) for the western blotting of the lysates from the mentioned cell lines. Cadherin-23 (HPA017232, Sigma-Aldrich and PA5-43398, Invitrogen), eGFP (A11122, Invitrogen), and His-tag (11965085001, Roche) antibodies were used at the concentration of 1 μg/ml to detect the proteins.
RNA from different cancer cell lines was extracted using RNA isolation kit (Bio Rad) and treated with DNAse using DNAse 1 kit (AMPD1, Sigma-Aldrich). cDNA synthesis was done using a cDNA synthesis kit (Bio Rad). qRT-PCR was performed with the primers probing Cdh23 using the real-time PCR system (CFX96 Bio Rad).
RNA from different cancer cell lines was extracted using RNA isolation kit (Bio Rad) and treated with DNAse using DNAse 1 kit (AMPD1, Sigma-Aldrich). cDNA synthesis was done using a cDNA synthesis kit (Bio Rad). qRT-PCR was performed with the primers probing Cdh23 using the real-time PCR system (CFX96 Bio Rad).
4
Validating Differential miRNA Expression in Tilapia Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To validate and characterize the differentially expressed miRNAs identified in testis and ovaries of Nile tilapia, miRNAs were selected and analyzed their relative expression by quantifying the miRNA stem-loop. The total RNAs were isolated using RNA isolation kit (Bio-Rad, Richmond, CA), following cDNA generated using 1 µg of total RNA by reverse transcription kit (Invitrogen, Carlsbad, CA). Quantitative realtime PCR was performed on ABI 7500 PCR system (Applied Biosystems, Foster City, CA) and using qPCR/Real-Time PCR Reagents provided by Bio-rad (Richmond, CA). The primers were showed in supplement data (Table S1 in File S1 ). The PCR reactions were performed as follows: 10 minutes at 95°C, and then 40 cycles of 30 seconds at 95°C, 1 minute at 60°C. For each sample, the samples were tested in triplicate. Finally, polyacrylamide gel electrophoresis and melting curve were performed to confirm if the amplifications were specific. β-actin was used as an internal control.
5
Skeletal Muscle RNA Extraction Protocol
6
Comprehensive RNA-seq Workflow for Nerve Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA-seq was performed essentially as we described previously (Aaker et al., 2016 ; Elbaz et al., 2018 (link); Xu et al., 2020 (link)). In brief, RNA samples were prepared and isolated from sciatic nerve or DRG using RNA isolation kit following the manufacture’s protocol (Bio-Rad, Cat# 732–6820). RNA quality was confirmed by 2100 Bioanalyzer using a model 6000 Nano kit (Agilent technologies, Cat# 5067–1511). Samples with RNA integrity number >8 were used. Libraries were prepared and sequenced at the University of Chicago Genomics Core facility using the Illumina HiSeq 4000. Reads were mapped using both STAR v2.6.1a and Kallisto v.0.44.0 using bowtie 2 aligner (Bray et al., 2016 (link); Dobin et al., 2013 (link)). Mapped reads were further analyzed with the Bioconductor suite v3.7 (Huber et al., 2015 (link)) by the University of Illinois at Chicago Bioinformatics Core facility. Q-values were determined as false discovery rate adjusted p values using the method previously described (Benjamini and Yekutieli, 2005 ).
7
Cytokine Expression Profiling after PsA-D Treatment
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To determine cytokine expression levels after PsA-D treatment, the following primers were used (purchased from Eurofins, Ebersberg): IL-6 forward (GGCACTGGCAGAAAACAACC), IL-6 reverse (GCAAGTCTCCTCATTGAATCC) IL-8 forward: (ACTGAGAGTGATTGAGAGTGGAC), IL-8 reverse: (AACCCTCTGCACCCAGTTTTC), TNFα forward: (GCCTGCTGCACTTTGGAGTG), TNFα reverse: (TCGGGGTTCGAGAAGATGAT), MCP-1 forward: (CCCCAGTCACCTGCTGTTAT), MCP-1 reverse: (TGGAATCCTGAACCCACTTC), GAPDH forward: (TGCACCACCAACTGCTTAGC), GAPDH reverse: (GGCATGGACTGTGGTCATGAG), GR forward: (AAAAGAGCAGTGGAAGGACAGCAC) GR reverse: (GGTAGGGGTGAGTTGTGGTAACG). Total RNA was isolated with QIAGEN (Hilden, Germany) RNA Isolation Kit according to manufacturer’s instructions and reverse transcriptase PCR were performed with iScript RT cDNAse Kit from BioRad (Munich, Germany). Real-time PCR was conducted with Quantitect SYBR Green from QIAGEN (Hilden, Germany) based on the following protocol: pre-incubation at 95 °C for 900 s, amplification was performed over 45 cycles (95 °C for 15 s, 55 °C for 25 s and 72 °C for 10 s). No-template controls served as negative control. CT values were calculated according to the method [62 (link)]. Sample values were normalized to the house-keeping gene GAPDH (glyceraldehyde 3-phosphate dehydrogenase).
8
Quantitative Analysis of Ferulic and Isoferulic Acids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HPLC-grade acetonitrile (CH3CN) and methanol were purchased from Sigma-Aldrich (St. Louis, MO, USA), while analytical grade formic acid was obtained from Huadong Chemical Reagent Co. Ltd. (Hangzhou, China). Deionized water was purified using a Milli-Q system (Millipore, Bedford, MA, USA). Other reagents were of analytical grade.
Ferulic acid (LOT#110773-200611, purity greater than 99.0%) and isoferulic acid (LOT#11698-200602, purity greater than 99.0%) were purchased from the National Institute for the Control of Pharmaceutical and Biological Products (Beijing, China). Antibodies against Caspase-3 (CASP3) and β-actin were purchased from Cell Signaling Technology (Danvers, MA, USA). The RNA isolation kit was obtained from Bio-Rad (cat# 163-2098, Bio-Rad, Hercules, CA, USA).
Ferulic acid (LOT#110773-200611, purity greater than 99.0%) and isoferulic acid (LOT#11698-200602, purity greater than 99.0%) were purchased from the National Institute for the Control of Pharmaceutical and Biological Products (Beijing, China). Antibodies against Caspase-3 (CASP3) and β-actin were purchased from Cell Signaling Technology (Danvers, MA, USA). The RNA isolation kit was obtained from Bio-Rad (cat# 163-2098, Bio-Rad, Hercules, CA, USA).
9
Western Blotting and qRT-PCR of Cancer Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We have followed the standard protocol (Hirano, 2012) for the western blotting of the cell lines. Cadherin-23 (HPA017232, Sigma-Aldrich and PA5-43398, Invitrogen), eGFP (A11122, Invitrogen) and His-tag (11965085001, Roche) antibodies were used to detect the proteins.
RNA from different cancer cell lines was extracted using RNA isolation kit (Bio-Rad) and treated with DNAse using DNAse 1 kit (AMPD1, Sigma-Aldrich). cDNA synthesis was done using cDNA synthesis kit (Bio-Rad). qRT-PCR was performed with the primers probing the real-time PCR system (CFX96 Bio-Rad).
RNA from different cancer cell lines was extracted using RNA isolation kit (Bio-Rad) and treated with DNAse using DNAse 1 kit (AMPD1, Sigma-Aldrich). cDNA synthesis was done using cDNA synthesis kit (Bio-Rad). qRT-PCR was performed with the primers probing the real-time PCR system (CFX96 Bio-Rad).
10
NK92 Cytotoxicity on MCF7 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MCF7 cells had been transwelled with induced NK92 cells (IL15 with various concentration 0, 5, 10 ng/ml) for 24 h. Afterward, microscopic analysis was conducted under inverted phase-contrast microscope. Subsequently the MCF7 cells were collected to isolate the RNA. The RNA isolation of MCF7 was performed based on the protocol of RNA Isolation Kit (Bio-Rad, 732-6820). The concentration and purity of RNA of each sample was determined at 260/280 nm. The cDNA synthesis was performed using cDNA synthesis kit (Bio-rad, 170-8841) (Widowati et al. 2018; Afifah et al. 2019; Widowati et al. 2019) . Primer sequences can be seen at Table 2.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!