Cfx connect

Manufactured by Thermo Fisher Scientific

Sourced in United States

The CFX Connect is a real-time PCR (Polymerase Chain Reaction) system designed for gene expression analysis, genotyping, and other molecular biology applications. It features a compact and user-friendly design, advanced optics, and intuitive software for accurate and efficient data collection and analysis.

Automatically generated - may contain errors

Lab products found in correlation

8 protocols using cfx connect

Renal Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from the kidney cortex of the mice and from the human podocytes using RNeasy Protect Mini Kit (QIAGEN, Valencia, CA). The extracted RNA was transcripted into the first‐strand cDNA using the Omniscript RT kit (QIAGEN), according to the manufacturer's protocol. Quantitative reverse transcriptase–polymerase chain reaction was performed using a CFX connect (Applied Biosystems, Foster City, CA) with TaqMan Universal PCR Master Mix (Applied Biosystems). The specific primers and probes (Applied Biosystems) were acquired to detect PAR‐2 (Assay ID: Mm00433160_m1 and Hs00608346_m1); monocyte chemoattractant protein (MCP)‐1 (Assay ID: Mm00441342_m1 and Hs00234140_m1); tumor necrosis factor (TNF)‐α (Assay ID: Mm0043258_m1 and Hs00174128_m1); PAI‐1 (Assay ID: Mm00435860_m1); interleukin‐6 (Assay ID: 00985639_m1); synaptopodin (Assay ID: Hs00702468); and glyceraldehyde‐3‐phosphatase dehydrogenase (GAPDH) (Assay ID: Mm99999915_g1 and Hs02758991_g1). The results were normalized by GAPDH.

Ichikawa H., Shimada M., Narita M., Narita I., Kimura Y., Tanaka M., Osanai T., Okumura K, & Tomita H. (2019). Rivaroxaban, a Direct Factor Xa Inhibitor, Ameliorates Hypertensive Renal Damage Through Inhibition of the Inflammatory Response Mediated by Protease‐Activated Receptor Pathway. Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease, 8(8), e012195.

+ Open protocol

+ Expand

Cardiac Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Hearts were rapidly excised, and the atrium was removed and stored in liquid nitrogen. Total RNA was extracted from left ventricles using the RNeasy Fibrous Tissue Mini Kit (Qiagen), according to the manufacturer's protocol. The RNA was converted into cDNA using the Primescript II 1st standard cDNA synthesis kit (Takara Bio). Quantitative polymerase chain reaction was performed using CFX Connect (Applied Biosystems) with TaqMan Universal PCR Master Mix (Applied Biosystems). Specific primers were purchased from Applied Biosystems to detect PAR‐1 (assay ID, Mm00438851_g1), TNF‐α (tumor necrosis factor‐α; assay ID, Mm0043258_m1), TGF‐β1 (transforming growth factor‐β1; assay ID: Mm01178820_m1), α‐myosin heavy chain (α‐MHC; assay ID, Mm00440346_g1), β‐MHC (assay ID, Mm00600532_g1), COL3A1 (collagen type 3 α1; assay ID: Mm01254476_m1), and GAPDH; assay ID: Mm99999915_g1). The mRNA expression levels were normalized by GAPDH.

Yokono Y., Hanada K., Narita M., Tatara Y., Kawamura Y., Miura N., Kitayama K., Nakata M., Nozaka M., Kato T., Kudo N., Tsushima M., Toyama Y., Itoh K, & Tomita H. (2020). Blockade of PAR‐1 Signaling Attenuates Cardiac Hypertrophy and Fibrosis in Renin‐Overexpressing Hypertensive Mice. Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease, 9(12), e015616.

+ Open protocol

+ Expand

Quantifying Mitochondrial DNA Copy Number

Check if the same lab product or an alternative is used in the 5 most similar protocols

To determine mtDNA copy number relative to genomic DNA, the total DNA extract was subjected to qPCR using the Biorad CFX Connect^™ real-time PCR detection system with PowerUp^™ SYBR® Green Master Mix (Applied Biosystems) in 10 μl reactions according to the manufacturer’s directions. The qPCR reactions were performed in triplicate with primers mB2MR1: 5’ CAG TCT CAG TGG GGG TGA AT 3’, mB2MF1: 5’ATG GGA AGC CGA ACA TAC TG 3’, mMitoR1: 5’ CCA GCT ATC ACC AAG CTC GT 3’, mMitoF1: 5’ CTA GAA ACC CCG AAA CCA AA 3’ [19 (link)]. These primers were designed against mtDNA sequences not duplicated in the nuclear genome (NUMTs) and as such are likely to yield higher mtDNA copy number values than those seen in prior studies[19 (link)]. The qPCR temperature cycle was as follows: 1. 50°C for 2:00, 2. 95°C for 2:00, 3. 95°C for 0:15, 4. 60°C for 1:00, 5. Repeat 3–4 39x. Primer efficiency was calculated using the slope of the Cq vs. log(DNA concentration) line of four quintuplicate ten-fold dilutions. Efficiency = -1+10^(-1/slope). For both primers, the R² value was >0.99. MtDNA copy number = mB2MF_efficiency^{Average mB2MF Cq} / mMito_efficiency^{Average mMito Cq}. To verify our qPCR, we sequenced several full genomic extract samples and calculated the copy number from sequencing using the total mitochondrial genome coverage divided by the total nuclear genome coverage.

Maclaine K.D., Stebbings K.A., Llano D.A, & Rhodes J.S. (2020). Voluntary wheel running has no impact on brain and liver mitochondrial DNA copy number or mutation measures in the PolG mouse model of aging. PLoS ONE, 15(3), e0226860.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Kidney Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from the kidney cortex of the mice using RNeasy Protect Mini Kit (QIAGEN, Valencia, CA, USA). RNA was transcribed into first-strand cDNA using Omniscript RT kit (QIAGEN) according to the manufacturer's protocol. Quantitative reverse transcription polymerase chain reaction (RT-PCR) was performed using CFX connect (Applied Biosystems, Foster City, CA, USA) with TaqMan Universal PCR Master Mix (Applied Biosystems). The specific primers and probes (Applied Biosystems) were acquired to detect ACE2 (assay ID: Mm 001159003_m1), Mas1 (assay ID: Mm00434823_s1), Nox4 (assay ID: Mm00479246_m1), and glyceraldehyde-3-phosphatasedehydrogenase (GAPDH) (assay ID: Mm 99999915_g1 and Hs02758991_g1). The results were normalized by the mRNA expression levels of GAPDH.

Ichikawa H., Narita I., Narita M., Tanno T., Yokono Y., Kimura Y., Tanaka M., Osanai T., Okumura K, & Tomita H. (2018). Blood Pressure-Independent Effect of Olmesartan on Albuminuria in Mice Overexpressing Renin. International heart journal, 59(6).

+ Open protocol

+ Expand

Quantifying mRNA Expression in Ishikawa Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total mRNA was isolated from Ishikawa cells treated for 6 hrs using the Qiagen RNeasy mini kit with RNase-Free DNase treatment on-column according to the manufacturer’s protocol (Qiagen, Valencia, CA). RNA quality and concentration were assessed by spectrophotometry with the NanoDrop One (Thermo Fisher Scientific). RNA was subjected to cut-off values of >1.8 for the A260/A280 ratio and >1.6 for the A260/A230 ratio. Quantitative RT-PCR (qRT-PCR) was performed in a 10 μl reaction with 100 ng RNA using a one-step reaction on the Bio Rad CFX384 thermal cycler or CFX Connect thermal cycler using predesigned primer-probe sets (Supplemental Table 3; Thermo Fisher Scientific). The thermocycling parameters for each reaction were: 48°C for 30 min, 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec and 60°C for 60 sec. The amplification signal from the reference gene peptidylprolyl isomerase B (PPIB), which was unaffected by chemical treatment, was used to normalize the amplification signals from each gene primer-probe. All qRT-PCR analysis was determined from 5 biological replicates, which were each evaluated as technical duplicates.

Alofe O., Kisanga E., Inayat-Hussain S.H., Fukumura M., Garcia-Milian R., Perera L., Vasiliou V, & Whirledge S. (2019). Determining the Endocrine Disruption Potential of Industrial Chemicals Using an Integrative Approach: Public Databases, In Vitro Exposure, and Modeling Receptor Interactions. Environment international, 131, 104969.

+ Open protocol

+ Expand

Total RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from the TRIzol™ reagent‐intestinal organoid solution combined with a commercially available spin‐column kit (RNeasy Micro, Qiagen, Hilden Germany). Chloroform was added to samples in TRIzol™ and then samples were spun down at 15,000 × g for 15 min. The resulting supernatant was then transferred to a new tube and equal volumes of 70% ethanol were added. Samples were then transferred to spin columns and kit protocol was followed. Next, cDNA was synthesized using the Maxima First Strand cDNA Synthesis Kit (ThermoFisher Scientific). Real‐time polymerase chain reaction using a BioRad CFX Connect was used to analyze mRNA expression using Maxima SYBR green (ThermoFisher Scientific). Data were analyzed using the Delta–Delta Ct (2^−∆∆Ct) method and presented as relative fold gene expression. Treatments were all made relative to controls, which were set to equal one. All samples were standardized to 18S expression as a housekeeping gene, and 18S values were determined to be statistically similar between treatment groups (p > 0.05). β‐actin, RPL32, and 18S were tested prior to choosing an adequate housekeeping gene and 18S was chosen due to stability. Primer sequences are listed in Table S1.

Pearce S.C., Weber G.J., Doherty L.A, & Soares J.W. (2022). Human iPSC colon organoid function is improved by exposure to fecal fermentates. FASEB BioAdvances, 4(7), 468-484.

+ Open protocol

+ Expand

Rabbit Knee Cartilage mRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The medial femoral condylar cartilage of the rabbit’s right leg was taken, and total mRNA was extracted with Trizol (15596026, Ambion, America). Total mRNA was reversely transcribed into cDNA using the RevertAid First Strand cDNA Synthesis Kit (K1622, Thermo Scientific, America). Finally, RT-qPCR was performed thrice using the CFX Connect^TM fluorescence quantitative PCR instrument with the PowerUp^TM SYBR^TM Green Master Mix (A25742, Thermo Scientific, America). The sequences of gene primers (Sangon Biotech Co., Ltd. Shanghai) used for measurement are shown in Table 1. Glyceraldehyde 3-phosphate dehydrogenase mRNA was used as an endogenous control. Relative transcript levels of mRNA were reported using the 2^−ΔΔCT method.

Table 1

The gene primers

Gene	F/R	Primers (5’ to 3’)
COL2A1	Forward	CCCAGAACATCACCTACCA
COL2A1	Reverse	CAGTCTTGCCCCACTTACC
MMP13	Forward	TGCGGGAATCCTGAAGAAGAATGC
MMP13	Reverse	TCAAGTTTGCCTGTCACCTCTAAGC
ITG-β1	Forward	GCCATCCAGACGACATAGAGAATCC
ITG-β1	Reverse	TGCCTTTGCTACGGTTGGTGAC
GAPDH	Forward	ACTCTGGCAAAGTGGATGTTGTCG
GAPDH	Reverse	CCGTGGGTGGAATCATACTGGAAC

Li Y., Hou Y., Sun J., Wei J., Chai Y., Guo M, & Wang R. (2023). Therapeutic Effect of Acupotomy at Sanheyang for Cartilage Collagen Damage in Moderate Knee Osteoarthritis: A Rabbit Model. Journal of Inflammation Research, 16, 2241-2254.

+ Open protocol

+ Expand

Quantitative mRNA and lncRNA Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols

Equal amounts of RNA (whole cell, nuclear and cytoplasmic lysates) or equal volumes (polysome fractions) were subject to cDNA synthesis, using qScript (Quanta Bio) according to manufacturer's instructions. qPCR was performed using the CFX Connect TM thermal cycler and quantification using SYBR Green fluorescent dye (PowerUp TM SYBR Green Master Mix, Thermo Fisher SCIENTIFIC). Primers were designed to anneal to exon-exon junctions, where possible, or to common exons between alternative transcripts (Primer Table ). Target mRNA and lncRNA levels were assessed by absolute quantification, by the means of standard curve or relative quantification, using the ΔΔCq method.

Douka K., Birds I., Wang D., Clayton S., Byford A., Vasconcelos E.J.R., O’Connell M.J., Deuchars J., Whitehouse A., & Aspden J.L. (2020). LncRNAs interacting with the translation machinery contribute to human neuronal differentiation.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!