Leica mz16 stereomicroscope

Fly heads were removed from newly eclosed flies. Heads were passed through a graded alcohol series for 24 hours each (25%–50%–75%-absolute), passed through Hexamethyldisalizane, and mounted on EM stubs using carbon tape (Ted Pella). Fly heads were dried for 24 hours, sputter coated with gold, and examined with a Hitachi scanning electron microscope at an accelerating voltage of 20 kV. Images were acquired as TIFF files that were collated using Adobe Illustrator. For quantitative analysis of eye size (facet number), crosses were established in duplicates, and ≥15 adult flies for each genotype were photographed using a Leica MZ16 stereomicroscope equipped with a Leica DFC-480 digital camera. Facet numbers were manually counted from TIFF images of the eyes and subjected to statistical analysis. For bristle phenotypes, newly eclosed adults were photographed using a Leica MZ16 stereomicroscope or by scanning EM. For quantitative analysis of the bristle phenotypes, multiple crosses were established (triplicates), and adults were scored for bristle defects. Wing margin phenotypes were documented using a Leica MZ16 stereomicroscope. Eye size (facet counts) and bristle and wing defects were statistically analyzed using the Student’s t-test, with the exception of Fig. 1F, which was determined using the chi-squared test.

Approval for zebrafish research was obtained from the University Committee on the Use and Care of Animals (UCUCA) of the University of Freiburg. Transgenic wt1b::GFP zebrafish line was raised and maintained as described60 (link). Fertilized eggs were microinjected with 4 nl of injection solution at the one-to-two-cell stage with MOs (Gene Tools LLC) diluted in 200 mM KCl, 0.1% Phenol Red (Sigma-Aldrich Corporation) and 10 mM HEPES. zFat1 MO has been previously described47 (link). About 0.5 pmol of zebrafish p53 MO (5′- GCGCCATTGCTTTGCAAGAATTG -3′, Gene Tools) was always co-injected to reduce the unspecific effects of the MOs61 (link). About 1.6 pmol zFat1 MO was injected either alone or together with either 1 μg ml⁻¹ of Rho/Rac/Cdc42 Activator I or 0.5 U ml⁻¹ of Rac/Cdc42 activator II (Cytoskeleton). Scoring of percentage of cyst formation and zebrafish embryo imaging was done on mixed male and female embryos at 48 h post fertilization under a Leica MZ16 stereo microscope (Leica).

Worms mounted with the glass-bottom dish method were imaged with two alternative stereomicroscope set-ups: an Olympus SZ60 stereomicroscope (Olympus, Tokyo, Japan) equipped with a DinoEye AM423x eyepiece camera (BigC.com, Torrance, CA, USA) and a Leica MZ16 stereomicroscope (Leica, Wetzlar, Germany) equipped with a Nikon D80 DSLR camera (Nikon, Tokyo, Japan). Both cameras were interfaced to a PC computer through USB serial ports and operated using manufacturer’s software (Fig. 2, lower left). The microscope was focused at a focal plane of interest and images were captured at regular intervals (2–5 min) with a pixel resolution of 1024 × 768 (DinoEye) or 1936 × 1296 (Nikon D80). Images were then compiled as single XYT stacks, cropped and exported as uncompressed or JPG compressed AVI video files using ImageJ [62 ]. Video file post-processing and re-encoding, if needed, was done using VirtualDub (http://www.virtualdub.org) and online editing at YouTube (http://www.YouTube.com).