A chromatin immunoprecipitation (ChIP) assay was carried out using the ChiP-IT Express Enzymatic Magnetic Chromatin Immunoprecipitation Kit or the Re-ChIP-IT kit (Active Motif, Carlsbad, CA) according to the manufacturer’s protocol. Approximately 300 mg of liver tissue was minced, homogenized, and fixed with 1% formaldehyde for the in vivo ChIP assay. The following ChIP primer sets were used for the ChIP assay: human AHR ChIP primer set I (−283 to 90, forward): 5′-TTA GCT GAC CCA CCG TCT CT-3′, (−283 to −90, reverse): 5′-TCC ATT CCG TCT TCC TTG AG-3′; human AHR ChIP primer set II (−1969 to −1779, forward): 5′-TTA GCT GAC CCA CCG TCT CT-3′, (−1969 to −1779, reverse): 5′-TTG GCT ATT TGG TGC AGT CA-3′; Mouse AHR ChIP primer set (−138 to +141, forward): 5′-AGA ACC TCG GAC TGC AAG AA-3′, (−138∼ +141, reverse): 5′-AGT CCG TCC ACC AGT TCG T-3′. For ChIP assays, NR2E3 antibody from Santa Cruz Biotech (Cat#: sc-292264) or Aviva Systems Biology (Cat#: ARP39069) was employed. All the ChIP-PCR reactions were performed using a 7300HT Real-Time PCR System with a 96-well block module (Applied Biosystems). The cycling conditions were 56 °C for 30 min and 95 °C for 10 min, followed by 50 cycles of 95 °C for 25 s and 60 °C for 60 s.
7300ht real time pcr system
Manufactured by Thermo Fisher Scientific
Sourced in United States
The 7300HT Real-Time PCR System is a laboratory instrument designed for quantitative real-time polymerase chain reaction (qRT-PCR) analysis. It provides thermal cycling, fluorescence detection, and data analysis capabilities to enable quantification of nucleic acid targets.
Automatically generated - may contain errors
Lab products found in correlation
96 well block module, by Thermo Fisher Scientific (4 mentions)
Rneasy mini kit, by Qiagen (3 mentions)
Chip it express enzymatic magnetic chromatin immunoprecipitation kit, by Active Motif (2 mentions)
Re chip it kit, by Active Motif (1 mentions)
Miscript sybr green kit, by Qiagen (1 mentions)
Quantitect reverse transcription kit, by Qiagen (1 mentions)
Rneasy minelute cleanup kit, by Qiagen (1 mentions)
Cdna synthesis kit, by Meridian Bioscience (1 mentions)
Sensimix sybr kit, by Meridian Bioscience (1 mentions)
Sybr green pcr kit, by Qiagen (1 mentions)
Rna polymerase 2, by Active Motif (1 mentions)
Chip it express chromatin immunoprecipitation kit, by Active Motif (1 mentions)
Quantstudio 3 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Chip it express magnetic chromatin immunoprecipitation kit, by Active Motif (1 mentions)
Primer express 3, by Thermo Fisher Scientific (1 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
Thermoscript reverse transcriptase kit, by Thermo Fisher Scientific (1 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
Rneasy kit, by Qiagen (1 mentions)
12 protocols using 7300ht real time pcr system
1
Chromatin Immunoprecipitation (ChIP) Assay
2
Chromatin Immunoprecipitation of Estrogen Receptors
3
miRNA Expression Analysis in Lung Macrophages
4
Quantitative Analysis of IL-24 and PKR in Glioma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from glioma tissue specimens and cell cultures and quantified by spectrophotometry (required OD260/OD280 ratio, 1.8–2.0). After reverse transcription, cDNA was combined with GAPDH (internal control), IL-24, or PKR primers on a 7300 HT Real-Time PCR system (Applied Biosystems, Foster City, CA, USA) for amplification. Relative gene expression levels were calculated using ABI 7300 System SDS Software v1.3.2.10.
Primers were synthesized by Shanghai Biological Engineering Co., Ltd. (Shanghai, China). The primer sequences were as follows: GAPDH (upstream primer 5′-TGAACGGGAAGCTCACTGG-3′ and downstream primer 5′-GCTTCACCACCTTCTTGATGTC-3′); IL-24 (upstream primer 5′-CAGGCGGTTTCTGCTATTCC-3′ and downstream primer 5′-GGCGTGAAGTGTCCAGTGAA-3′); PKR (upstream primer 5′-GGAAAGCGAACAAGGAGTAAGG-3′ and downstream primer 5′-CCAAAGCGTAGAGGTCCACT-3′).
Primers were synthesized by Shanghai Biological Engineering Co., Ltd. (Shanghai, China). The primer sequences were as follows: GAPDH (upstream primer 5′-TGAACGGGAAGCTCACTGG-3′ and downstream primer 5′-GCTTCACCACCTTCTTGATGTC-3′); IL-24 (upstream primer 5′-CAGGCGGTTTCTGCTATTCC-3′ and downstream primer 5′-GGCGTGAAGTGTCCAGTGAA-3′); PKR (upstream primer 5′-GGAAAGCGAACAAGGAGTAAGG-3′ and downstream primer 5′-CCAAAGCGTAGAGGTCCACT-3′).
5
Quantifying HER2 Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cultured cells using RNeasy® Mini Kit (Qiagen) according to the manufacturer's instructions, quantified using Thermo Scientific NanoDrop® ND-100, and then converted to cDNA using cDNA Synthesis Kit (Bioline, London, UK). HER2 expression was determined using 5′–AGTACCTGGGTCTGGACGTG–3′ (forward) and 5′–CTGGGAACTCAAGCAGGAAG -3′ (reverse) as primer sequences. PCR reactions were prepared using 2.0 μL of cDNA diluted in SensiMix™ SYBR kit (Bioline). qRT-PCR analysis was performed using the Applied Biosystems 7300-HT Real-Time PCR System. Levels of genes mRNA were expressed in relative copy numbers normalized against the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (comparative Ct method, 2–ΔΔCt).
6
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using Trizol (Tianjin, China) reagent based on the manufacturer’s protocols. Total RNA was reverse transcribed to synthesize cDNA by fastquant RT Kit (Tianjin, China). cDNA was amplified using SYBR Green PCR kit (QIAGEN, Germany) and 7300 HT Real-time PCR system (Applied Biosystems, United States). Real-Time PCR detection was based on the method published by Liu et al. (2018) (link). The primers are presented in Table 3 . The housekeeping gene (GAPDH) was used as internal control. The mean cycle threshold (Ct) values of the gene were determined using the two ΔΔCt method. Each sample was tested three times.
7
MALAT1 Promoter ChIP Assay with AHR and RNAPII
8
Chromatin Immunoprecipitation Assay Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The chromatin immunoprecipitation (ChIP) assay was carried out using ChiP-IT Express Magnetic Chromatin Immunoprecipitation Kit (Active Motif, Carlsbad, CA) according to manufacturer's protocol. The Chip primer sets used for Chip assay: Primer I (forward: − 1558), 5′-TTG CCA CAT GAA GCA ATA GG-3′, Primer I (reverse: − 1090), 5′-CAG ACC CTT CCA CTG TTC GT-3′; Primer II (forward: − 458), 5′-CTG GTT CAA ACT TGG CTT CC-3′, Primer II (reverse: − 214), 5′-CTC CAC TGC CTT CTG AGT CC-3′; Primer III (forward: + 607), 5′-AGT CCG CAC TCA GAC AAA GG-3′, Primer III (reverse: + 1189) 5′-CAA GTT GGC CAA AAC AGC TT-3′. The positive (GAPDH) and negative primer (CNAP1) sequences were previously described [10] (link), [11] (link). Chip-PCR was performed using the 7300HT Real-Time PCR System with a 96-well block module (Applied Biosystems) with Primer II. Cycling conditions were 56°C for 30 min and 95°C for 10 min, followed by 50 cycles of 95°C for 25 s and 60°C for 60 s.
9
Gene Expression Profiling of Cell Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For gene expression profiling, cell pellets from 0.5 ml of pooled lavage were suspended in 350 µl of RNA Later™ containing β‐ME and frozen. Total mRNA extracted from the cell pellets with an RNeasy Mini kit (Qiagen), and reversed transcribed with a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) Standard curves were generated by serial dilutions from pooled cDNA samples. Real time PCR was performed with SYBR Green PCR Master Mix (Applied Biosystems) on an Applied Biosystems 7300HT real time PCR system. Glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) was used as a house keeping gene to normalize the data. Full‐length coding sequences were obtained from the NCBI Gene Bank and primers were designed with Primer Express 3.0 software (Applied Biosystems).
Microarray procedure was performed according to the manufacturer’s instructions. Hybridization to Affymetrix GeneChip HT MG430PM array plates and processed on a GeneTitan workstation following the manufacturer’s protocol. The fold changes were calculated as the ratio of the expression level in each cell type versus the second highest expression level in all cell types. We focused on the genes that showed statistically significance of p ≤ .5 with ≥1.5‐fold up or down from controls.
Microarray procedure was performed according to the manufacturer’s instructions. Hybridization to Affymetrix GeneChip HT MG430PM array plates and processed on a GeneTitan workstation following the manufacturer’s protocol. The fold changes were calculated as the ratio of the expression level in each cell type versus the second highest expression level in all cell types. We focused on the genes that showed statistically significance of p ≤ .5 with ≥1.5‐fold up or down from controls.
10
Quantifying Gene Expression via qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
2 μg of total RNA from cells, isolated with RNeasy kit (Qiagen), was used to synthesize cDNA using the ThermoScript™ Reverse Transcriptase kit (Life Technologies). Then, qRT-PCR was performed using TaqMan® gene expression assay for murine samples (Usp54, Mm00513373_m1) or Power SYBR® Green PCR Master Mix for human cells (Life Technologies), using an Applied Biosystems 7300HT Real-Time PCR System. Relative expression was calculated as RQ=2−ΔΔCt.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!