Pdonr p4 p1r

The APP1 (At5g53540) promoter was amplified from WT genomic DNA and inserted into either pDonr P4P1R or pDonr221 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocol. APP1 cDNA was inserted into pDonr221. The pAPP1::GUS-GFP construct was generated using Gateway technology (www.thermofisher.com/gateway.html) [54 (link)] by inserting the APP1 promoter into the binary vector pKGWFS7. The pAPP1::GFP-APP1 construct was similarly generated [54 (link)] by inserting the APP1 promoter and cDNA into the binary vector pB7m34GW. The p35S::GFP-APP1 construct was constructed by introducing the APP1 cDNA into the binary vector pK7WGF2.0. Each of the transgenes was first transformed into Agrobacterium tumefaciens GV3101 and from thence into a WT A. thaliana plant using the floral dip method. The primers used to generate constructs are provided in S1 Table.

Tg(fli1:EGFP)^yl, stl (15 (link)), TgBAC(cldn15la-GFP)^pd1034 (34 (link)), Tg(fli1:dsRed)^um13 (62 (link)), Tg(lyve1:dsRed2)^nz101 (63 (link)), Tg(flt1_9a_cFos:GFP)^wz2 (63 (link)), Tg(EPV.Tp1-Mmu.Hbb:EGFP)^ia12 (27 (link)), and Tg(-2.8fabp10a:EGFP)^as3 (22 (link)) have been previously described.
To generate apo14:APOB25-IRESmCherry and apo14:APOB34-IRESmCherry, the zebrafish apo14 promoter (47 (link)) was cloned into pDONRP4-P1R (Invitrogen, Thermo Fisher Scientific), human APOB25 and APOB34 (45 (link)) were cloned into pDONR221 (Invitrogen, Thermo Fisher Scientific), and the IRESmCherry sequence was cloned into pDONRP2R-P3 (Invitrogen, Thermo Fisher Scientific), using Gateway BP Clonase II (Invitrogen, Thermo Fisher Scientific, 11789-020). The 3 vectors were then transferred into pDestTol2pA2 (62 (link)) using a Gateway LR reaction (Invitrogen, Thermo Fisher Scientific, 12538-120). The plasmids were injected along with Tol2 transposase mRNA into 1-cell-stage embryos (62 (link)).

An alkaline protease gene (alk) from A. flavus AF13 (GenBank accession number AF324246) was selected as the target for suppression. The construct used in this study was a Gateway-based vector constructed in a similar manner as previously reported [37 (link)]. The 5′ and 3′ arms of the alk coding region were PCR amplified using specific primers (Forward GCG TTA CCG TTG TAG GCA AG and Reverse TCC AGA AGA GCA ACA ACC GC) (Table S1) and cloned into pDONR P4-P1R and pDONR P2RP3 (Invitrogen, Carlsbad, CA, USA), respectively, using BP clonase as previously described [37 (link)]. The derived vectors, namely, pENTR-L4-5′alk-R1 and pENTR-R2-3′alk-L3 were confirmed by sequencing. The pDONR221-PR10-intron-CmR containing a PR10 intron was constructed previously [37 (link)]. pENTR-L4-5′alk-R1, pENTR-R2-3′alk-L3 and the pDONR221-PR10 intron-CmR vectors were combined with the pBS-d35S-R4-R3 vector to produce pBS-d35S-attB4-5′alk-attB1-PR10 intron-CmR-attB2-3′alk-attB3 vector using LR clonase (Invitrogen, Carlsbad, CA, United States). EcoRI and SacI were used to digest the vector and the resulting d35S-attB4-5′alk-attB1-PR10 intron-CmR-attB2-3′alk-attB3 cassette was cloned into pTF102 at the corresponding restriction sites [38 (link)]. The resulting maize RNAi transformation vector (pTF102-d35S-alk RNAi vector) (Figure S1) was sequenced to verify the assembly.

The zpc0.5 (zp3) promoter [32 (link)] was amplified from genomic DNA using primers (attB sequences underlined) fwd: GGGGACAACTTTGTATAGAAAAGTTGAAAATCCCCATGACATGCTGC and rev: GGGGACTGCTTTTTTGTACAAACTTGATTGCCTGCTGACTAATTAAACC and used in Gateway recombination-based cloning with pDONRP4-P1R (Invitrogen) to produce 5’ entry vector p5E-zp3. An LR reaction was performed using p5E-zp3, pME-CFP-NTR [20 (link),33 (link)], and pTolDestR4-R2pA [62 (link)] to produce pBD557. To generate transgenic animals, *AB embryos were co-injected at the one-cell stage with 5 picoliters of Tol2 transposase mRNA, prepared as described in [63 (link)], and pBD557 plasmid DNA at 5 ng/μl each. Germ-line transgenic founders were identified by screening for CFP expression in germ cells between 25 and 35 days post fertilization using a Leica MZ16 fluorescent stereomicroscope. A single founder was outcrossed to *AB to produce the Tg(zp3:CFP-NTR)^uc54 transgenic line used in this study.

The 1.1‐kb promoter of PRT1 was amplified from genomic DNA with the primer pair AttB4_PRT1pro_For and AttB1R_PRT1pro_Rev and the full‐length genomic sequence of PRT1 without stop codon was amplified with primer pairs AttB1_PRT1_For and AttB2_PRT1_nonstop. These products were then recombined into pDONR P4‐P1R and pDONR221 vectors (Invitrogen) to generate pEN‐L4‐promPRT1‐R1 and pEN‐L1‐gPRT1‐L2, respectively. Both of the entry vectors were sequenced, and recombination reactions were carried out with pEN‐R2‐GStag‐L3 and pKCTAP (Van Leene et al., 2008) to generate construct MO14, using a Multisite Gateway^® LR Recombination Reaction (Invitrogen), according to manufacturer's instructions. Transformation into Agrobacterium tumefaciens (strain AGL‐1) and Arabidopsis thaliana prt1‐1 were performed according to established protocols (Clough & Bent, 1998), and transgenic plants were selected using kanamycin and subsequently methotrexate.

The IKU2 promoter was amplified using the primers Prom-IKU2-B4 and Prom-IKU2-B1R (Supplementary Table 7) and cloned into pDONR-P4-P1R (Life Technologies). A triple LR Gateway reaction (Life Technologies) was then performed using the pIKU2-pENTR-R4-L1, 3X-VENUS-N7-pENTR-L1-L2, and 3’-ter-pENTR-R2-L3 plasmids as entry vectors and the pH7m34GW plasmid as destination vector to generate a pIKU2::3X-VENUS-N7-pH7m34GW construct (conferring Hygromycin resistance in plants).