Linear DNA fragments containing the T7 RNA polymerase promoter sequence upstream of the desired 20 bp gRNA protospacer and the gRNA backbone were generated by PCR (Q5 Hot Start MasterMix, New England Biolabs) using the appropriate forward and reverse primers (Table S1 ) and were concentrated on MinElute columns (Qiagen). The gRNA was transcribed with the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) at 37°C for 14–16 h with 150–400 ng of linear template per 20 μl reaction. gRNA was purified using the MEGAClear Transcription Clean Up Kit (Thermo Fisher) according to the manufacturer’s instructions. Purified gRNAs were stored in aliquots at −80°C.
Q5 hot start master mix
Manufactured by New England Biolabs
Q5 Hot Start Master Mix is a high-fidelity, 2X concentrated PCR master mix formulated for robust and efficient amplification. The mix contains Q5 High-Fidelity DNA Polymerase, reaction buffer, dNTPs, and MgCl2.
Automatically generated - may contain errors
Lab products found in correlation
Nebuilder hifi dna assembly master mix, by New England Biolabs (4 mentions)
Megaclear transcription clean up kit, by Thermo Fisher Scientific (3 mentions)
Minelute column, by Qiagen (3 mentions)
Hiscribe t7 high yield rna synthesis kit, by New England Biolabs (3 mentions)
Neb 5 alpha chemically competent e coli, by New England Biolabs (2 mentions)
Gblock, by Integrated DNA Technologies (2 mentions)
Nebuilder hifi dna assembly kit, by New England Biolabs (1 mentions)
Quick blunting kit, by New England Biolabs (1 mentions)
Neb 5 alpha, by New England Biolabs (1 mentions)
Hifi dna assembly master mix, by New England Biolabs (1 mentions)
Quick ligation kit, by New England Biolabs (1 mentions)
Qiaprep spin miniprep kit, by Qiagen (1 mentions)
Sanger sequencing, by Genewiz (1 mentions)
Monarch pcr dna cleanup kit, by New England Biolabs (1 mentions)
Kapa library quantification kit, by Roche (1 mentions)
Dna ffpe tissue kit, by Qiagen (1 mentions)
Pgex4t2 expression vector, by GE Healthcare (1 mentions)
T4 dna ligase, by New England Biolabs (1 mentions)
Proteinase k, by New England Biolabs (1 mentions)
Monarch dna gel extraction kit, by New England Biolabs (1 mentions)
20 protocols using q5 hot start master mix
1
Synthesizing CRISPR gRNA by In Vitro Transcription
2
Recombinant DNA Techniques for Plasmid Construction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All plasmids were cloned using standard recombinant DNA techniques. Recoded cDNA fragments were designed by using non sub-optimal alternative codons from cut site to stop codon and thus maintaining the exact amino acid sequence of each target gene upon insertion. In all instances, codon usage was kept as similar as possible to that of the endogenous sequence. All fragments were synthesized as gBlocks™ (Integrated DNA Technologies) and cloned into the desired vector. Plasmid and genomic DNA sequences were amplified using Q5 Hotstart Master Mix (New England Biolabs, Cat. #M0494S) and Gibson assembled with NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs, Cat. # E2621). Resulting plasmids were transformed into NEB 5-alpha chemically-competent E. coli (New England Biolabs, Cat. # C2987), isolated and sequenced. Primer sequences used for the creation of the different plasmids can be found in Supplementary Table 1 .
3
Molecular Cloning: Engineering Borrelia Plasmids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The plasmids pTM61strep,gfp,vlsEA3 (prMP09) and pTM61strep,gfp,vlsEECM (prMP10) were constructed by inserting the wild-type B31 A3 [28 (link)] vlsE gene or the vlsEECM mutant gene (see above) into the AscI restriction site of pTM61strep,gfp [8 (link)] as follows: The 5’ end of the vlsE open reading frame (containing the putative lipoprotein signal sequence) was amplified by PCR using Q5 Hot Start Master Mix (New England Biolabs) and primers prMP141 and prMP135 (S1 Table
4
Efficient sgRNA Generation via PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Linear DNA fragments containing the T7 RNA polymerase promoter sequence upstream of the desired 20 bp sgRNA protospacer and the sgRNA backbone were generated by PCR (Q5 Hot Start MasterMix, New England Biolabs) using primers as listed in the Supplementary Note 3 and concentrated on minelute columns (Qiagen). sgRNA was transcribed with the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) at 37 °C for 14–16 h with 1 μg of linear template per 20 μl reaction. sgRNA was purified using the MEGAClear Transcription Clean Up Kit (Thermo Fisher), according to the manufacturer's instructions. Purified sgRNAs were stored in aliquots at −80 °C.
5
Detecting RUSTI Integration and Excision via PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR reactions were performed using Q5 Hot Start Mastermix (New England Biolabs). Where JB182 RUSTI is integrated in the chromosome, PCR using primer 1 (CAACTGTGCCACGCAATTCA) and primer 2 (CGGCTACTTCTCGGATGGTC) are expected to produce a 1037 bp product that includes the 5’ ICE repeat. Primer 3 (CGCAATCGTGGTGTATCTGC) and primer 4 (GACGGGATCAGGAACGACG) should produce a 1410 bp product, while primer 5 (GCCGCATCTACCTCGATGAA) and primer 6 (CCAAATCGCGACGCATTGAT) are expected to form a 1467 bp product. Primers 1 and 6 are separated by approximately 59 kb when RUSTI is present and are not expected to form a PCR product, but should form a 1937 bp product if RUSTI is excised. Primers 2 and 5 should not form a PCR product when RUSTI is integrated, but would form a 500 bp product if the excision circle were present.
6
Mouse Genomic DNA Isolation and Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
C57BL/6J mouse genomic DNA was isolated from tail biopsies or brain pieces containing microdissected dorsal raphe by digestion in DNA lysis buffer (50 mM KCl, 50 mM Tris-HCl (pH 8.0), 2.5 mM EDTA, 0.45% NP-40, 0.45% Tween-20, 0.5 ug/mL proteinase K) for 3 hr at 55°C, and 1 hr at 65°C. Lysates were then used as templates to amplify a 654 basepair fragment including the 390F gRNA target site using Q5 HotStart Master mix (New England Biolabs). A portion of the finished PCR reaction was treated with Bgl I restriction enzyme (New England Biolabs) for 60 min and processed on an AATI fragment analyzer.
7
Generating Plasmids for In Vitro HIV RNA Transcription
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To generate a plasmid for in vitro transcription of HIV RNA, the HIV insert from the pSG3.1 strain (30 (link)) was PCR amplified with Q5 HotStart Master Mix (NEB M0494S) in two fragments, with an overlap in the PR locus to add a D25A mutation and both an EcoRI/T7 promoter and PolyA/BamHI sites at the 5′ and 3′ ends of the insert. A pUC19 backbone was PCR amplified with overlaps to the T7 promoter site at the 5′ of insert and PolyA tail at the 3′ end. PCR-amplified insert and vector fragments were assembled with NEBuilder HiFi DNA Assembly kit (NEB E2621S) and plated onto LB-Amp. Single colonies were grown, mini prepped, and sequenced to verify plasmid identity and orientation of all fragments. For nomenclature purposes, this sequence is referred to as a ‘wild-type’ strain throughout.
Additional mutants were designed based on this SG3.1 ‘wild-type’ background, all containing the following mutation pairs: T632A/A633G with A1951G, G2550T with C3875A, A1597C with A4106G. These mutations were added via PCR amplification with primers that generate overlaps for subsequent NEBuilder HiFi assembly. All modified plasmids containing mutation pairs were grown from single colonies and sequenced to verify sequence identity.
Additional mutants were designed based on this SG3.1 ‘wild-type’ background, all containing the following mutation pairs: T632A/A633G with A1951G, G2550T with C3875A, A1597C with A4106G. These mutations were added via PCR amplification with primers that generate overlaps for subsequent NEBuilder HiFi assembly. All modified plasmids containing mutation pairs were grown from single colonies and sequenced to verify sequence identity.
8
Targeted Genome Editing Using CRISPR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Homologous arms for each locus were amplified from the w1118 wild-type genomic DNA, and D.mim pb locus was amplified from wild-type genomic DNA using Q5 Hot Start Master Mix (New England Biolabs, catalog no. M0494S) and Gibson assembled with NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs, catalog no. E2621). Full sequences of guide RNAs (gRNAs) and oligos can be found in tables S1 to S3. Plasmid sequence data have been deposited on Mendeley Data (https://data.mendeley.com/datasets/xk59988f7z/2 ).
9
Sanger Sequencing for Genomic DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For Sanger sequencing, genomic DNA was extracted from a single fly per replicate following the method described by Gloor GB and colleagues56 . tgRNA and gRNA target sites were amplified with the help of specific primers and using the Q5 Hot-start master mix (NEB #M0494S). PCR products were purified prior to Sanger sequencing. Data were analyzed using an ICE tool by Synthego (https://ice.synthego.com/ ).
10
Engineered Protein Regulation System
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!