The sub-cellular localization of HSDL2 protein in MDA-MB-231 cells was detected by using IF staining. Cells were grown on coverslips to 70–80% confluence and fixed in 4% paraformaldehyde for 10 min. Then, the cells were permeabilized with 0.5% Triton X-100 for 10 min. Blocking was performed using 3% Albumin Bovine V (A8020, Solarbio, Beijing, China) in PBS supplemented with 0.3% Triton X-100 for 1 h at RT. Anti-HSDL2 Antibodies (15631-1-AP, Proteintech) were diluted in 1% BSA/PBS/0.3% Triton X-100 and incubated with the cells at 4 °C overnight. After washing with PBS, the cells were incubated with fluorochrome-labelled secondary antibodies (Alexa Fluor® 568 goat anti-rabbit IgG (H+L)) (A11004, 1:1,000, Invitrogen, USA) for 1 h at RT. Next, the cells were counterstained with DAPI (C1006, Beyotime, Shanghai, China). Finally, the fluorescence signals were detected with a Leica SP5II confocal microscope (Heidelberg, Germany).
Albumin bovine 5 a8020
Manufactured by Solarbio
Sourced in China
Albumin Bovine V (A8020) is a laboratory product that serves as a source of bovine serum albumin. It is a protein commonly used in various cell culture and biochemical applications.
Automatically generated - may contain errors
Lab products found in correlation
Alexa fluor 568 goat anti rabbit igg h l, by Thermo Fisher Scientific (1 mentions)
4 6 diamidino 2 phenylindole (dapi), by Beyotime (1 mentions)
Sp5 2 confocal microscope, by Leica (1 mentions)
Cell culture chamber, by Corning (1 mentions)
Fetal bovine serum (fbs), by Procell (1 mentions)
Rpmi 1640, by Procell (1 mentions)
Dulbecco s modified eagle s medium dmem, by Procell (1 mentions)
2 protocols using albumin bovine 5 a8020
1
Subcellular Localization of HSDL2 in MDA-MB-231 Cells
2
Nanomedicine for Alzheimer's Disease Treatment
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chlorogenic acid (327‐97‐9) and ZnNO3 (10196‐18‐6) were purchased from Aladdin (Shanghai, China). DSPE‐PEG2000‐NH2 (R‐0038) was obtained from Xi'an Ruixi Biological Technology (China). Cell Counting Kit‐8 (CCK8) (K1018) was purchased from Apexbio (China). DAPI (C0060), Hoechst 33342 (C0031), RIPA lysis buffer (R0010), sheep erythrocyte hemolysin (H8360), 4% sheep red blood cell (SRBC) (S9045), guinea pig serum (complement) (S4990), and Albumin Bovine V(A8020) were purchased from Solarbio Life Science (China). The Calcein/PI Assay Kit (C2015S) and Lyso‐Tracker Red (C1046)/green (C1047S) fluorescent probe were purchased from Beyotime Biotechnology (China). Aβ1‐42 and FITC‐Aβ1‐42 were obtained from QYAOBIO (Shanghai, China). Dulbecco's modified Eagle's medium (DMEM), RPMI‐1640, and fetal bovine serum (FBS) were obtained from Procell (China). The cell culture chamber was purchased from Corning Incorporated (ME, USA). TfR aptamer (TfR‐A), Aβ aptamer (AAP), and CD22 shRNA plasmid (RNAi) were synthesized by Genechem Co., Ltd. Biotech (Shanghai, China).
Their sequences are as follows:
John Wiley & Sons, Ltd.
Their sequences are as follows:
| TfR‐A aptamer | 5″‐CGTAAATCAGTCAGAAGGCGTGGTACCACGCGCT/iFAMdT/TC‐3″ |
| Aβ aptamer | 5′ 6‐FAM1‐TGGGGGGCGGACGATAGGGGCCCCCCGGTAGGATGGAC G‐3′ BHQ1 |
| CD22 shRNA‐a | 5′‐CCCGGGCAACAAACTACACCTGGTATCTCGAGATACCAGGTGTAGT TTGTTGCTTTTTG‐3′ |
| CD22 shRNA‐b | 5′‐AATTCAAAAAGCAACAAACTACACCTGGTATCTCGAGATACCAGG TGTAGTTTGTTGC‐3′ |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!