Neocortex was carefully dissected from E15.5/E17.5 PGKCre, Rosa26tdTomato embryos and digested in EBSS with 20 U/mL papain, 0.005% DNase (Papain dissociation kit, Worthington) for 25 min at 37 °C. Samples were then mechanically dissociated in EBSS with 0.005% DNase and cells were resuspended at 5 × 104 cells per µL in Neurobasal medium (Life Technologies), supplemented with 1 × SM1 supplement (Stem Cell), 200 mM L-Glutamine and 1× penicillin–streptomycin (both from Life Technologies). Cells were seeded on scaffolds as previously described [27 (link),51 (link)]: (i) scaffolds were placed in a syringe along with a cell suspension of approximately 3 × 105 cells; (ii) the plunger was introduced, and the syringe tip was closed using a 3-way valve; finally (iii) vacuum was induced by moving the plunger about 3 cm up and down until the scaffold was fully impregnated and became transparent. Scaffolds were then placed in 12-well plates. Culture medium was replaced after five days by BrainPhys supplemented with 1X SM1 supplement (both from Stem Cell).
Sm1 supplement
Manufactured by STEMCELL
SM1 supplement is a defined, animal component-free medium supplement designed to support the culture of human pluripotent stem cells. It contains a proprietary blend of molecules that help maintain the self-renewal and pluripotency of human embryonic stem cells (hESCs) and induced pluripotent stem cells (hiPSCs).
Automatically generated - may contain errors
Lab products found in correlation
Glutamax, by Thermo Fisher Scientific (4 mentions)
L glutamine, by Thermo Fisher Scientific (3 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (2 mentions)
Neurobasal medium, by Thermo Fisher Scientific (2 mentions)
B27 supplement, by Thermo Fisher Scientific (2 mentions)
Odyssey detection system, by LI COR (2 mentions)
Srebf1 primary antibody, by Proteintech (2 mentions)
Scd cd e10 antibody, by Abcam (2 mentions)
Irdye 800cw goat anti mouse igg, by LI COR (2 mentions)
Ripa lysis buffer, by Thermo Fisher Scientific (2 mentions)
Irdye 680rd goat anti rabbit igg, by LI COR (2 mentions)
Nupage gel, by Thermo Fisher Scientific (2 mentions)
Complete mini edta free protease inhibitor cocktail, by Roche (2 mentions)
Wet tank blotting, by Bio-Rad (2 mentions)
Neurobasal a growth media, by Thermo Fisher Scientific (2 mentions)
Papain, by Thermo Fisher Scientific (2 mentions)
Antibiotic antimycotic, by Thermo Fisher Scientific (2 mentions)
Papain, by Worthington (2 mentions)
Brainphys neuronal medium, by STEMCELL (2 mentions)
Non essential amino acids (neaa), by Thermo Fisher Scientific (2 mentions)
10 protocols using sm1 supplement
1
Neocortex Isolation and Culture Scaffold Seeding
2
Primary Neuronal Culture from Rat Embryos
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cortices from rat embryos (E17–18) were dissected, dissociated, and plated on 96-well tissue-culture plates (0.5–1×105/well) or on 24-well tissue-culture plates (0.2–0.7×106/well) coated with poly-D lysine as described24 (link)26 (link)60 (link)61 (link)62 (link). Neurons were grown in modified neuronal growth medium made from Neurobasal Medium (Life Technologies), B-27 supplement (Life Technologies) or SM1 supplement (STEMCELL), GlutaMAX (Life Technologies), and penicillin-streptomycin (Life Technologies) for 1 month. Although no serum is present in our media, glial cells still proliferate and become confluent after about 2–3 weeks in culture. We do not add an inhibitor of glial proliferation to the media. Some cultures were transfected with the pDRIVE-hSynapsin-mApple (Lipofectamine 2000, Invitrogen) at 4–5 DIV. Although some transfection protocols suggest that it is not necessary to remove the DNA:Lipofectamine 2000 complexes, we always remove complexes from neuronal cultures after 0.5–1 h. Longer incubations with Lipofectamine 2000 result in significant toxicity. Low transfection efficiency is not a problem for our analyses. We routinely obtain hundreds of transfected neurons per 96-well plate and even more for 24-well plate.
3
Western Blot Analysis of Lipid Metabolism Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Protein lysates were prepared in RIPA lysis buffer (ThermoFisher Scientific) with cOmplete Mini EDTA-free Protease Inhibitor Cocktail (Roche). Western blot was performed using NuPAGE gel (ThermoFisher Scientific) with wet tank blotting (Bio-Rad) and Odyssey detection system (LI-COR). SREBF1 primary antibody (14088-1-AP, Proteintech), SCD (CD.E10) antibody (ab19862, Abcam), GAPDH (D16H11) XP rabbit monoclonal antibody (5174S, Cell Signaling), β-actin (8H10D10) mouse monoclonal antibody (3700S, Cell Signaling), and IRDye 800CW goat anti-mouse IgG (926-32210, LI-COR), IRDye 680RD goat anti-rabbit IgG (926-68071, LI-COR) secondary antibodies were used. Western blot was performed for cells cultured in different medium conditions. These include RPMI1640 with 10% FBS, with 10% delipidated FBS, with 10% human cerebrospinal fluid (991-19-P-5, Lee BioSolutions), or with 1% SM1 supplement (05711, STEMCELL Tech), or brain-slice-conditioned medium. Brain-slice-conditioned medium was prepared by submerging brain slices (150 μm) in RPMI1640 (no serum) for 48 h. Delipidated FBS was prepared as described51 (link).
4
Primary Mixed Neuron-Glia Culture Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primary mixed neuron-glia cultures were prepared from postnatal day 0 (P0) C3HBL/6 mouse brains (Harlan Labs). Cerebral cortices were dissected from P0 mouse brains and were dissociated in 2 mg/ml papain (Worthington) and 50 μg/mL DNAse I (Sigma) at 37 °C for 20 min. They were then washed three times in sterile Hank’s balanced salt solution (HBSS) to inactivate the papain and switched to 5 % fetal bovine serume (HyClone) in Neurobasal-A growth media (Gibco), which includes 0.5 mM L-glutamine (Gibco), 0.5 mM GlutaMax (Life Technologies), 0.01 % antibiotic-antimycotic (Gibco), and 0.02 % SM1 supplement (Stemcell). The tissue mixture was then triturated three times using a 5 mL pipette followed by a Pasteur pipette, and strained through a 70 μm cell strainer. The cell mixture was then centrifuged at 200xg for 3 min, and re-suspended in fresh Neurobasal-A media. They were then plated onto poly-D-lysine coated 96well plates at 100,000 cells/well. Cells were maintained in the Neurobasal-A growth media mentioned above without fetal bovine serum (FBS) at 37 °C in a humidified 5 % CO2 chamber.
5
Murine Cortical Neuron Isolation and Culture
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cortices of mice at embryonic day 14.5 (E14.5) for transfection and TrkB phosphorylation assays and E17.5 for immunostaining studies were collected in Hanks’ buffered salt solution (Sigma-Aldrich) and trypsinized in 1 mg/ml trypsin (Worthington) for 20 min at 37°C. The reaction was then stopped using 1 mg/ml trypsin inhibitor (Sigma-Aldrich) before the addition of 1 mg/ml DNase I (Thermo Fisher Scientific) and gentle dissociation with a 5 ml serological pipette. Cells were then pelleted by centrifugation at 1400 rpm for 5 min and resuspended in DMEM supplemented with 2% FBS, 1% GlutaMAX, and 1% Penstrep. Three hours after plating into wells coated with poly-d -lysine (Sigma-Aldrich), cells were maintained in Neurobasal medium supplemented with 1% GlutaMAX supplement, 1% Penstrep, and 2% SM1 supplement (Stem Cell Technologies). Neurons were cultured for up to 12 d with 50% media changes performed three times weekly. Subsequent transfections were performed on E14.5 neurons at 5DIV using 0.5 μg of indicated DNAs and 1 μl of Lipofectamine 2000 (see above). Depolarization of E17.5 neurons at DIV11 was achieved by supplementing media with 1 mm 4-aminopyridine (4-AP; Merck) for 24 h.
6
Western Blot Analysis of Lipid Metabolism Proteins
7
Differentiation of Glutamatergic and GABAergic Neurons
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
NPCs were differentiated according to the Bardy, et al. protocol.46 (link) Cells were maintained in the neuronal differentiation medium for 14 or 21 days. iCell GlutaNeurons and GABAneurons were differentiated according to the manufacturer recommendations (FujiFilm Cellular Dynamics). Cells were maintained in their respective BrainPhys complete media for 14 days. KOLF2.1J-hNGN2 iPSCs were dissociated using Accutase and plated as single cells at 50,000 cells/cm2 in Induction Medium: DMEM/F12 medium with HEPES (ThermoFisher), 100x N2 supplement (StemCell Technologies), 100X Non-essential amino acids (NEAA, ThermoFisher), and 100X Glutamax (ThermoFisher). For plating cells, Induction Medium was supplemented with 5mM Y-27632 and 2 mg/mL Doxycycline. Induction medium supplemented with Doxycycline was renewed daily for two days. On day 3 neurites were present, and cells were renewed with Cortical Neuron Culture Media: BrainPhys neuronal medium (StemCell Technologies), 50X SM1 supplement (StemCell Technologies), 10 μg/mL BDNF (StemCell Technologies), 10 μg/mL NT-3 (StemCell Technologies), and 1 mg/mL Mouse Laminin (Gibco). On day 3, Cortical Neuron Culture Media was supplemented with 2 mg/mL Doxycycline. One-half media changes were performed every other day for a total of 14 days.
8
Neuronal Differentiation of Neural Progenitors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
NPCs were reseeded
on 20 ng/mL laminin and poly-d -lysine-coated plates in NPC
culture medium for 1 day. Then, half-medium change with neuronal differentiation
medium composed of BrainPhys medium (Stem Cell, 5792), 1× SM1
supplement (Stem Cell, 5711), 1× N2 supplement, 20
ng/mL BDNF (Peprotech, 450-02-10), 20 ng/mL GDNF (Peprotech, 450-10-10),
and 200 nMl -ascorbic acid (Sigma, A92902). The cells were
fed by half-change of the medium every 3 days. For the first culture
change only, 200 nM compound E (Calbiochem, 565790) was added. In
the first 2 weeks of differentiation, 1 mM dibutyryl cyclic AMP (dbcAMP,
Cayman, 14408) was added. Once a week, 1 μg/mL laminin was added
when doing the half-change. Thereafter, the cells were fed by performing
half-media change until Day 28 for future experiments.
on 20 ng/mL laminin and poly-
culture medium for 1 day. Then, half-medium change with neuronal differentiation
medium composed of BrainPhys medium (Stem Cell, 5792), 1× SM1
supplement (Stem Cell, 5711), 1× N2 supplement, 20
ng/mL BDNF (Peprotech, 450-02-10), 20 ng/mL GDNF (Peprotech, 450-10-10),
and 200 nM
fed by half-change of the medium every 3 days. For the first culture
change only, 200 nM compound E (Calbiochem, 565790) was added. In
the first 2 weeks of differentiation, 1 mM dibutyryl cyclic AMP (dbcAMP,
Cayman, 14408) was added. Once a week, 1 μg/mL laminin was added
when doing the half-change. Thereafter, the cells were fed by performing
half-media change until Day 28 for future experiments.
9
Establishing Primary Mouse Cortical Cultures
10
Differentiation of iPSCs to Neurons
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
18WT: GGCCTAAGAACACCGTTACCCAATGAG Mut a: GGCCTAA----------------TGAG (-16) Mut b: GGC-------------TACCCAATGAG (-13) Differentiation of iPSCs to neural progenitors (NPs) and neurons in adherent culture was performed as described in [37] with slight modi cation. Brie y, on day 0, con uent iPSCs were passaged onto Matrigelcoated dishes and cultured in AK03N medium (Ajinomoto). On day 1, doxycycline was added into the medium to induce expression of Ngn2. On day 2, an equal volume of N2 medium was added to the AK03N medium and N2 medium was used on day 3-4. On day 5, an equal amount of NB medium was added to the N2 medium and NB medium was used on day 6-8. From day 5, Cytosine arabinoside (AraC) was added to the medium to inhibit proliferation of NPs. N2 medium contains DMEM/F12, 1X N2 supplement (Invitrogen), 1X NEAA (Invitrogen), mouse laminin (0.2ug/mL), NT-3 (10ng/mL), and BDNF (10ng/mL). NB medium contains Neurobasal, 1X B-27 supplement (Invitrogen), 1X GlutaMAX-I supplement (Invitrogen), mouse laminin (0.2ug/mL), NT-3 (10ng/mL), and BDNF (10ng/mL). From day 11, BrainPhys Neuronal Medium and SM1 supplement (Stem Cell Technology) were used to promote further neural maturation.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!