Endotoxin free maxiprep kit

The CNR1 proximal promoter fragment was amplified from human placental DNA using the following primers: forward 5′ CGCAGCCAGGTAGCGAACG 3′ and reverse 5′ TTTCGTTCTAGCGGACAAC 3′. Primers were designed to amplify the negative genomic DNA strand since CNR1 is transcribed from this strand. Following PCR amplification, the specific CNR1 proximal promoter amplicon was cloned into a linearized pGEM–T Easy vector using T4 DNA ligase (Promega, Southampton, UK). The CNR1 proximal promoter fragment was then cloned into pGL4.23 (Promega, Southampton, UK) by digesting both vector and insert plasmids with EcoRI and SacI to form pCNR1prom-Luc. High quality pCNR1prom reporter plasmid was purified from transformed E. coli using an endotoxin free maxi prep kit (Qiagen, Manchester, UK).

The modified plasmids were purified using the Qiagen Endotoxin-free Maxi-prep kit. Transfection into human foreskin fibroblasts (UCSF cell culture facility, catalog number CCLZR211, log number MB3145, passages 9–20) was performed using the Neon Transfection system as described previously [13 (link)]. Lines carrying the transfected factors were designated with O (Oct3/4 + shp53), K (KLF4), S (Sox2), or M (L-Myc + Lin28) respectively, using uppercase or lowercase to designate high or low fluorescence. After electroporation, cells were plated onto Bovine bovine collagen I (Corning)-coated dishes in recovery medium (DMEM H21 with 10% FBS without antibiotics). Medium was changed the next day to DMEM with 10% FBS and 1× penicillin/streptomycin for continued culture into iPS cells. After 4 days, cells were gradually transitioned to mTesR iPS cell media as described previously [13 (link)].

Plasmids encoding the following genes were propagated: Gaussia luciferase (pGLuc; New England Biolabs, MA, USA), and stromal-derived factor 1 alpha (SDF-1α:Cayla-InvivoGen, Toulouse, France) and both were under the control of the cytomegalovirus promoter. Plasmids were propagated by chemically transforming One Shot™ TOP10 chemically competent E. coli (ThermoFisher Scientific, Dublin, Ireland) bacterial cells according to the manufacturers protocol and expanded in lysogeny broth in the presence of antibiotics for which the plasmids carry resistance genes. The E. coli cells carrying pLuc were expanded in 100 µg/mL ampicillin (FisherScientific, Dublin, Ireland), and pSDF-1α E. coli cells were expanded in 100 µg/mL blasticidin (Sigma Aldrich, Wicklow, Ireland). pDNA was purified and collected using the Endotoxin free Maxi-prep kit (Qiagen, Manchester, UK). Plasmid was dissolved in molecular grade water at a concentration of 1 µg/mL and stored at −20 °C.

To identify target sites for CRISPR-Cas9–mediated knockout, the genetic sequences of PRIM1 and EXOSC8 were obtained from the UCSC genome browser (http://genome.ucsc.edu) using the human assembly GRC38/Hg38 (December 2013). The 20 nucleotides upstream of the polymorphic PAM site containing the SNP for each gene constitutes the AS sgRNA for that gene. All other sgRNAs were designed using the CRISPR sgRNA design tool from the Zhang lab (http://crispr.mit.edu). sgRNAs were cloned into the appropriate vector as described previously^{80 (link),82 (link)}. Briefly, plasmids were cut and dephosphorylated with BsmBI (New England Biolabs) and FastAP (Fermentas) at 37 °C for 2 h. Oligonucleotides for each sgRNA guide sequence (Integrated DNA Technologies) were phosphorylated using T4 polynucleotide kinase (New England Biolabs) at 37 °C for 30 min and then annealed by heating to 95 °C for 5 min and cooling to 25 °C at 1.5 °C/min. Using Quick Ligase (New England Biolabs), annealed oligos were ligated into gel purified vectors (Qiagen) at 25 °C for 5 min. Cloned plasmids were amplified using a endotoxin-free maxi-prep kit (Qiagen).
The sgRNA sequences were as follows:
LacZ: GTTCGCATTATCCGAACCAT
PRIM1 AS: CAGCTCGGGCAGCTCGGTGG
PRIM1 NA: CGCTGGCTCAACTACGGTGG
EXOSC8 AS: CGGAATCTCGATGAACACAG
EXOSC8 NA: ACCGGAATCTCGATGAACAC