Abi 7700

Manufactured by Thermo Fisher Scientific

Sourced in United States

The ABI 7700 is a real-time PCR system designed for quantitative gene expression analysis. It utilizes fluorescent probe technology to detect and measure DNA sequences during the amplification process.

Automatically generated - may contain errors

Lab products found in correlation

24 protocols using abi 7700

Quantifying Gastrocnemius Muscle Myostatin

Check if the same lab product or an alternative is used in the 5 most similar protocols

High quality total RNA from the gastrocnemius muscle was isolated by RNAiso plus (9108, TaKaRa, Tokyo, Japan). Primary cDNA was synthesized by the HiScript II Q RT SuperMix with gDNA wiper kit (R223-01, Vazyme, Nanjing, China). Quantitative RT-PCR was performed with the AceQ qPCR SYBR Green Master Mix kit (Q141-02, Vazyme, Nanjing, China) in the sequence detector (ABI7700, Applied Biosystems, Foster City, CA, USA). The primers used for Mstn (KY441464) and 36b4 were as follows: Mstn, 5ʹ-AGAAGATGGGCTGAATCCCT-3ʹ (forward), 5ʹ-GAGTGCTCATCGCAGTCAAG-3ʹ (reverse); 36b4, 5ʹ-GAAACTGCTGCCTCACATCCG-3ʹ (forward), 5ʹ-GCTGGCACAGTGACCTCACACG-3ʹ (reverse). The data were analyzed using the ΔΔCT method of analysis and expressed as arbitrary units after normalization to the levels of expression of 36b4 for each sample.

Chen L., Su X, & Hu Y. (2020). Berberine Down-Regulated Myostatin Expression and Facilitated Metabolism via Smad Pathway in Insulin Resistant Mice. Diabetes, Metabolic Syndrome and Obesity: Targets and Therapy, 13, 4561-4569.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

mRNA was extracted using the NucleoSpin RNA II kit (Bioke) and reverse transcribed using the iScript cDNA Synthesis Kit (BioRad). All procedures were according to the manufacturers' instructions. Quantitative RT-PCR was performed in the ABI 7700 (Applied Biosystems) or 7900HT Fast Real-Time PCR. Gene abundances were detected with SYBR® Green (Eurogentec). mRNA expression was either normalized to 18S or Actin. Primer sequences can be found in Table S1.

van Gisbergen M.W., Offermans K., Voets A.M., Lieuwes N.G., Biemans R., Hoffmann R.F., Dubois L.J, & Lambin P. (2020). Mitochondrial Dysfunction Inhibits Hypoxia-Induced HIF-1α Stabilization and Expression of Its Downstream Targets. Frontiers in Oncology, 10, 770.

+ Open protocol

+ Expand

Quantifying HTPAP Expression in HCC

Check if the same lab product or an alternative is used in the 5 most similar protocols

Real-time quantitative RT-PCR (qRT-PCR) of HTPAP was described previously [6] (link). Briefly, total RNA was isolated from 420 HCC tissue specimens from Cohort 1; cDNA was synthesized with oligo(dT)15 primers and Superscript II (Invitrogen Life Technologies). The mRNA levels of HTPAP were determined by qRT-PCR with SYBR Green PCR Master Mix in an ABI 7700 (Applied Biosystems). The qRT-PCR and RT-PCR amplification primers are shown in Table S2. Each assay was performed in triplicate, and the products were checked on an agarose gel. The mRNA levels of HTPAP were also examined in 454 HCC tissues that were randomly selected from Cohort 2.
The western blot assay was performed as described in our previous work [13] (link). Thirty micrograms of proteins extracted from 216 randomly selected cases of HCC samples from Cohort 1 were immunoblotted. Rabbit anti-human HTPAP polyclonal antibody (1∶300 dilution, Santa Cruz, Oxford, United Kingdom) was used to detect the expression of HTPAP. GAPDH (1∶5,000; Chemicon, USA) was used as an internal control.

Wu J.C., Jia H.L., Li Z.R., Zhou K.L., Qin L.X., Dong Q.Z, & Ren N. (2014). Genomic Aberrations in the HTPAP Promoter Affect Tumor Metastasis and Clinical Prognosis of Hepatocellular Carcinoma. PLoS ONE, 9(3), e90528.

+ Open protocol

+ Expand

Real-time PCR analysis of apoptosis-related genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from PBMC and cDNA synthesized, as described previously [40 (link)]. Real-time PCR was performed using an ABI7700 sequence detection system (Applied Biosystems, Warrington, UK) in the presence of SYBR Green. Optimization of the real-time PCR reaction was performed according to the manufacturer’s instructions. Each gene transcript was normalized to the reference gene GAPDH. Primer sequences as follows:

GAPDH-F-5′-AACAGGGACACCCACTCCTC-3′,

GAPDH-R-5′-CATACCAGGAAATGAGCTTGACAA-3′,

BCL-2-F-5′-GTGGAGAGCGTCAACCGG-3′

BCL-2-R-5′-GGTTCAGGTACTCAGTCATCCACA-3′,

BAX-F-5′-GCCACTCCTCTGGGACCC-3′

BAX-R-5′-ACGCATTATAGACCACATCTGATG-3′,

T-BET/TBX21-F-5′- TCATTGCCGTGACTGCCTAC-3′,

T-BET/TBX21-R-5′- TGTACATGGACTCAAAGTTCTCCC-3′,

GATA3-F-5′- ACTGGAGGACTTCCCCAAGAAC-3′,

GATA3-R-5′-GGCGAGATGTGGCTCAGG-3′

Churchman S.M., El-Jawhari J.J., Burska A.N., Parmar R., Goëb V., Conaghan P.G., Emery P, & Ponchel F. (2014). Modulation of peripheral T-cell function by interleukin-7 in rheumatoid arthritis. Arthritis Research & Therapy, 16(6), 511.

+ Open protocol

+ Expand

Genotyping of CLU, APOE Polymorphisms

Check if the same lab product or an alternative is used in the 5 most similar protocols

We performed genotyping of the clusterin polymorphism at CLU rs11136000, APOE polymorphism at rs429358 (codon 112), and APOE polymorphism at rs7412 (codon 158) using the TaqMan assay (Applied Biosystems). A reaction volume of 25 μL containing 50 ng DNA, 5 mL MgCl₂ and 1X TaqMan Universal PCR Master Mix containing AmpliTaq Gold DNA Polymerase was amplified using 40 cycles of 15s at 95°C and 1 min at 60°C. A total of 0.2μM of each of the sequence-specific probes 5′-6FAM ACCAAAGCCACACCAGCTATCAAAA[T]TCTCTAACGGGCCCTTGCCACTTGA-TAMRA-3′ and 5′-VIC-ACCAAAGCCACACCAGCTATCAAAA[C]TCTCTAACGGGCCCTTGCCACTTGA-TAMRA-3′ was used in the allelic discrimination assay for rs11136000. For the allelic discrimination assay for APOE, sequence specific probes were also used: 5′ VIC-CCGCGATGC CGATGACCTGCAGAAG[C]GCCTGGCAGTGTACCAGGCCGGGGC–TAMRA-3′ and 5′FAM-CCGCGATGCCGATGACCTGCAGAAG[T]GCCTGGCAGT GTACCAGGCCGGGGC-TAMRA-3′ for rs7412 and 5′ VIC-GCTGGGCGCG GACATGGAGGACGTG[C]GCGGCCGCCTGGTGCAGTACCGCGG-TAMRA-3′ and 5′FAM-GCTGGGCGCGGACATGGAGGACGTG[T]GCGGCCGCCTGGT GCAGTACCGCGG-TAMRA-3′ for rs429358. Allele detection and genotype calling were performed using the ABI 7700 and Sequence Detection Software (Applied Biosystems).

Stevens B.W., DiBattista A.M., Rebeck G.W, & Green A.E. (2014). A gene-brain-cognition pathway for the effect of an Alzheimer’s risk gene on working memory in young adults. Neuropsychologia, 61, 143-149.

+ Open protocol

+ Expand

Validating Differentially Expressed miRNAs by qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Three differentially expressed miRNAs were validated by qPCR analysis using the TaqMan PCR kit (Applied Biosystems, Foster City, CA, USA) and ABI 7700 (Applied Biosystems, Foster City, CA, USA). The reactions were incubated in a 96-well plate at 95°C for 10 min, followed by 45 cycles of 95°C for 15 s and 60°C for 1 min. A comparative Ct method [32 (link)] was used to compare each group and the normal group. The relative levels of miRNAs were normalized to U6.

Zhang Q., Xiao X., Zheng J., Li M., Yu M., Ping F., Wang T, & Wang X. (2019). Vildagliptin, a dipeptidyl peptidase-4 inhibitor, attenuated endothelial dysfunction through miRNAs in diabetic rats. Archives of Medical Science : AMS, 17(5), 1378-1387.

+ Open protocol

+ Expand

Quantifying RNA Expression and Antioxidant Enzyme Activity

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from freshly prepared islets (n = 6 mice/group, 150 islets per sample) and PANC1 cells using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. Reverse transcription of RNA and real-time PCR were carried out using one step SYBR Green Master Mix regents and an ABI 7700 (Applied Biosystems, Foster City, CA, USA). The normalized expression levels of the genes were calculated by the 2^−ΔΔCt method, using β-actin, a ubiquitous cytoskeletal protein, as a control gene. The primers used are listed in Table S1. SOD1 activity was measured using a water-soluble formazan dye kit (Dojindo Molecular Technologies, Gaithersburg, MD, USA) according to the manufacturer’s instructions. GPX activity was determined using the coupled assay of NADPH oxidation using H₂O₂ as the substrate [32 (link)].

Wang H., Vatamaniuk M.Z., Zhao Z, & Lei X.G. (2023). Interdependencies of Gene Expression and Function between Two Redox Enzymes and REG Family Proteins in Murine Pancreatic Islets and Human Pancreatic Cells. Antioxidants, 12(4), 849.

+ Open protocol

+ Expand

Quantitative RNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from lungs tissues using RNeasy Mini Kit (Qiagen Inc) according to the manufacturer's instructions. qRT-PCR was performed using a sequence detector (ABI7700; Applied Biosystems) according to the manufacturer's instructions. The PCR primers used in this study are listed in Table 1. The gene expression levels for each amplicon were calculated using the ∆∆CT method and normalized against glyceraldehydes 3-phosphate dehydrogenase (GAPDH) mRNA expression.

Matsuyama M., Ishii Y., Sakurai H., Ano S., Morishima Y., Yoh K., Takahashi S., Ogawa K, & Hizawa N. (2016). Overexpression of RORγt Enhances Pulmonary Inflammation after Infection with Mycobacterium Avium. PLoS ONE, 11(1), e0147064.

+ Open protocol

+ Expand

Transcriptome Analysis via qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated using RNAlater Solution (Ambion), RNeasy mini kit (Qiagen), and DNase to remove residual chromosomal DNA (Qiagen) according to manufacturer's instructions. RNA concentration was measured by NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Inc.). cDNA was synthesized using the iScript cDNA synthesis kit (Bio Rad) and cDNA corresponding to 10 ng of input RNA was used as template for real-time reaction containing Power SYBR green (Applied Biosystems) and gene-specific primers. The primers were designed with Primer Express 3.0 software and tested for their amplification efficiencies (Table S2). The gyrB gene, encoding for the B subunit of the DNA gyrase, was utilized as endogenous control. The RT-PCR reactions were carried out at 95°C for 10 min, 95°C for 15 s and 60°C for 1 min for 40 cycles (ABI 7700, Applied Biosystems). The expression ratio of each gene was the average from three independent RNA samples and was normalized to the level of gyrB.

Li J., Overall C.C., Nakayasu E.S., Kidwai A.S., Jones M.B., Johnson R.C., Nguyen N.T., McDermott J.E., Ansong C., Heffron F., Cambronne E.D, & Adkins J.N. (2015). Analysis of the Salmonella regulatory network suggests involvement of SsrB and H-NS in σE-regulated SPI-2 gene expression. Frontiers in Microbiology, 6, 27.

+ Open protocol

+ Expand

Quantitative RT-PCR Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated by RNeasy mini kit, combined with RNA-free DNase for on-column DNase digestion (Qiagen) according to manufacturer’s instructions. cDNA was synthesized using the iScript cDNA synthesis kit (Bio Rad). The amount of cDNA corresponding to 10 ng of input RNA was used as template for real-time reaction containing Power SYBR green (Applied Biosystems) and gene-specific primers. The primers were designed with Primer Express 3.0 software and tested for amplification efficiencies (S2 Table). The gyrB gene, encoding for the B subunit of the DNA gyrase, was utilized as endogenous control. The RT-PCR reactions were carried out at 95°C for 10 min, 95°C for 15 s and 60°C for 1 min for 40 cycles (ABI 7700, Applied Biosystems). The expression ratio of each gene was the average from three independent RNA samples and was normalized to the level of gyrB.

Li J., Overall C.C., Johnson R.C., Jones M.B., McDermott J.E., Heffron F., Adkins J.N, & Cambronne E.D. (2015). ChIP-Seq Analysis of the σE Regulon of Salmonella enterica Serovar Typhimurium Reveals New Genes Implicated in Heat Shock and Oxidative Stress Response. PLoS ONE, 10(9), e0138466.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!